Incidental Mutation 'R7178:Atp8b2'
ID558749
Institutional Source Beutler Lab
Gene Symbol Atp8b2
Ensembl Gene ENSMUSG00000060671
Gene NameATPase, class I, type 8B, member 2
SynonymsId
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7178 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89939481-89963508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89943672 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 29 (D29G)
Ref Sequence ENSEMBL: ENSMUSP00000132201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000166502] [ENSMUST00000168276] [ENSMUST00000170739]
Predicted Effect probably damaging
Transcript: ENSMUST00000069805
AA Change: D1008G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: D1008G

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 80 96 N/A INTRINSIC
Pfam:E1-E2_ATPase 103 374 5.6e-18 PFAM
Pfam:HAD 408 842 1.3e-17 PFAM
Pfam:Hydrolase_like2 491 590 1e-11 PFAM
Pfam:Hydrolase 590 845 7.9e-8 PFAM
low complexity region 1133 1147 N/A INTRINSIC
low complexity region 1167 1190 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107396
AA Change: D1013G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: D1013G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 1.3e-29 PFAM
Pfam:E1-E2_ATPase 81 351 2.7e-9 PFAM
Pfam:HAD 389 847 1.5e-17 PFAM
Pfam:Cation_ATPase 472 571 4.3e-12 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2e-84 PFAM
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1172 1195 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166502
AA Change: D29G

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132201
Gene: ENSMUSG00000060671
AA Change: D29G

DomainStartEndE-ValueType
SCOP:d1eula_ 2 95 5e-7 SMART
low complexity region 100 109 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168276
AA Change: D989G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: D989G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:E1-E2_ATPase 84 355 2.5e-18 PFAM
Pfam:HAD 389 823 7.9e-18 PFAM
Pfam:Hydrolase_like2 472 571 3.6e-12 PFAM
Pfam:Hydrolase 571 826 6.5e-8 PFAM
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1148 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170739
SMART Domains Protein: ENSMUSP00000127720
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 82 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171941
SMART Domains Protein: ENSMUSP00000130545
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:HAD 2 158 3.3e-8 PFAM
Pfam:Hydrolase_3 124 167 1.7e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 A G 9: 54,628,461 I130T possibly damaging Het
Adam24 T A 8: 40,680,000 L169* probably null Het
Als2 A T 1: 59,207,812 I556N probably damaging Het
Ankrd44 A T 1: 54,649,440 N212K Het
Anpep T C 7: 79,840,988 D260G probably benign Het
Arhgap17 A T 7: 123,285,358 probably null Het
Atad2 C T 15: 58,117,293 R383Q probably damaging Het
Atp11b T A 3: 35,819,950 M696K probably benign Het
Atp13a2 A G 4: 140,999,151 T350A probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Cep250 T A 2: 155,973,455 L631* probably null Het
Clec4a3 T C 6: 122,964,292 I82T probably benign Het
Csmd3 T A 15: 47,590,774 I2648F Het
Cul5 A G 9: 53,644,526 F247L probably benign Het
D430042O09Rik T C 7: 125,866,327 V1317A probably benign Het
Dnajc24 A T 2: 105,970,462 M101K probably damaging Het
Dnhd1 T A 7: 105,694,993 V1848E probably damaging Het
Dspp A G 5: 104,174,066 T14A probably benign Het
Fam166a G A 2: 25,220,240 V55I probably damaging Het
Fam196b G T 11: 34,402,359 V134F probably damaging Het
Gm7298 T G 6: 121,785,896 I1392S probably damaging Het
Gm9955 A T 18: 24,709,163 S62R unknown Het
Gtsf1 T G 15: 103,419,961 N130T probably benign Het
Heatr5a C A 12: 51,925,142 S755I probably damaging Het
Hrc A G 7: 45,336,261 T279A possibly damaging Het
Hvcn1 T C 5: 122,233,510 W38R probably damaging Het
Hyal6 A G 6: 24,734,835 S256G probably benign Het
Ipo13 A G 4: 117,903,884 S546P possibly damaging Het
Kif24 A G 4: 41,395,085 V730A probably benign Het
L3mbtl2 T C 15: 81,671,074 V176A probably benign Het
Lgi1 T C 19: 38,306,285 Y502H probably damaging Het
Liph T A 16: 21,976,328 D178V probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mak16 A C 8: 31,166,574 S42A probably benign Het
Mamdc4 T C 2: 25,568,965 I269V probably benign Het
Mapk8ip3 A T 17: 24,901,754 M812K probably benign Het
Muc4 T A 16: 32,752,788 S889T unknown Het
Npy6r A G 18: 44,276,484 N324S probably damaging Het
Ntrk3 T G 7: 78,356,147 T489P possibly damaging Het
Olfr1102 G A 2: 87,002,535 V189I probably benign Het
Olfr187 T A 16: 59,035,933 D268V probably benign Het
Olfr69 G A 7: 103,767,975 Q141* probably null Het
Otof G C 5: 30,383,534 T887S possibly damaging Het
Papola T C 12: 105,807,184 V154A probably damaging Het
Pde4dip T C 3: 97,715,630 H1421R probably benign Het
Plpp5 T C 8: 25,720,579 S66P probably benign Het
Ppp6r3 T A 19: 3,518,337 I154L probably benign Het
Prr18 A C 17: 8,341,909 D299A possibly damaging Het
Psmb1 G A 17: 15,477,259 S198F possibly damaging Het
Qars T C 9: 108,515,123 V723A possibly damaging Het
Rab6a A T 7: 100,636,752 R185* probably null Het
Scn2a C T 2: 65,748,853 Q1511* probably null Het
Serpinb3d T A 1: 107,080,776 I120F possibly damaging Het
Serpini2 T C 3: 75,258,148 T175A probably damaging Het
Skiv2l T C 17: 34,839,464 T1226A probably benign Het
Slc17a6 A G 7: 51,667,511 I427V possibly damaging Het
Slc2a2 C T 3: 28,719,482 A312V possibly damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spcs1 G A 14: 31,000,481 S127F possibly damaging Het
Speg T C 1: 75,422,383 V2158A possibly damaging Het
Sptbn4 T A 7: 27,418,056 I423F probably damaging Het
Synj2 T A 17: 6,026,479 I930N possibly damaging Het
Tas2r140 T A 6: 133,055,660 D45V probably damaging Het
Tcf3 C A 10: 80,421,599 V11F unknown Het
Tead1 A T 7: 112,841,937 Q91L probably benign Het
Tgm5 T A 2: 121,085,768 probably benign Het
Tgoln1 C T 6: 72,616,045 G151S probably benign Het
Tnfrsf11a C A 1: 105,827,539 N445K probably benign Het
Ttn G C 2: 76,710,170 F34157L probably benign Het
Vmn2r91 C A 17: 18,136,162 P697Q probably damaging Het
Zeb2 G A 2: 44,996,994 L684F probably damaging Het
Zfp661 T C 2: 127,577,536 D228G probably benign Het
Zfp738 T C 13: 67,673,028 K77E probably damaging Het
Zkscan1 T A 5: 138,100,930 D378E probably damaging Het
Zswim9 T A 7: 13,259,997 D744V possibly damaging Het
Other mutations in Atp8b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Atp8b2 APN 3 89949853 missense probably damaging 1.00
IGL02472:Atp8b2 APN 3 89954239 missense probably damaging 1.00
IGL02651:Atp8b2 APN 3 89954589 unclassified probably null
IGL03057:Atp8b2 APN 3 89944186 missense probably damaging 1.00
IGL03349:Atp8b2 APN 3 89957817 missense probably damaging 1.00
IGL03382:Atp8b2 APN 3 89948521 missense probably benign 0.00
R0550:Atp8b2 UTSW 3 89959061 splice site probably benign
R0784:Atp8b2 UTSW 3 89957073 missense probably damaging 0.99
R1249:Atp8b2 UTSW 3 89947804 missense possibly damaging 0.77
R1447:Atp8b2 UTSW 3 89944170 missense probably damaging 1.00
R1568:Atp8b2 UTSW 3 89949848 missense probably damaging 0.98
R1647:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R1736:Atp8b2 UTSW 3 89952694 missense probably damaging 0.98
R1907:Atp8b2 UTSW 3 89946276 missense probably benign 0.28
R2656:Atp8b2 UTSW 3 89941758 missense probably benign 0.05
R2888:Atp8b2 UTSW 3 89958293 missense probably damaging 1.00
R3706:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3708:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3740:Atp8b2 UTSW 3 89946031 missense probably benign
R3741:Atp8b2 UTSW 3 89946031 missense probably benign
R3742:Atp8b2 UTSW 3 89946031 missense probably benign
R3896:Atp8b2 UTSW 3 89957319 missense probably damaging 1.00
R3914:Atp8b2 UTSW 3 89954448 missense probably damaging 0.98
R4536:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R4770:Atp8b2 UTSW 3 89957067 missense probably damaging 0.97
R4859:Atp8b2 UTSW 3 89945980 missense probably benign
R4905:Atp8b2 UTSW 3 89949008 missense probably benign
R4925:Atp8b2 UTSW 3 89946623 critical splice donor site probably null
R4955:Atp8b2 UTSW 3 89952920 unclassified probably benign
R5433:Atp8b2 UTSW 3 89952909 unclassified probably benign
R5458:Atp8b2 UTSW 3 89946022 missense probably benign 0.00
R5517:Atp8b2 UTSW 3 89946031 missense probably benign
R5663:Atp8b2 UTSW 3 89941794 missense probably benign 0.19
R6056:Atp8b2 UTSW 3 89946221 missense possibly damaging 0.79
R6821:Atp8b2 UTSW 3 89948173 missense probably damaging 0.99
R7069:Atp8b2 UTSW 3 89954571 missense probably damaging 1.00
R7533:Atp8b2 UTSW 3 89945524 missense
R7552:Atp8b2 UTSW 3 89946764 missense probably damaging 1.00
Z1088:Atp8b2 UTSW 3 89954568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAATAGCCTGTATCCAGC -3'
(R):5'- AAGCATGGAGTACCCTAAACTG -3'

Sequencing Primer
(F):5'- TTATTGAAGGGACGAGTACCCC -3'
(R):5'- TGGAGTACCCTAAACTGTACGAGC -3'
Posted On2019-06-26