Incidental Mutation 'R7178:Ipo13'
ID558752
Institutional Source Beutler Lab
Gene Symbol Ipo13
Ensembl Gene ENSMUSG00000033365
Gene Nameimportin 13
SynonymsKap13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R7178 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117894486-117914999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117903884 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 546 (S546P)
Ref Sequence ENSEMBL: ENSMUSP00000035989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036156
AA Change: S546P

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035989
Gene: ENSMUSG00000033365
AA Change: S546P

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
IBN_N 45 111 2.05e-7 SMART
Pfam:Xpo1 116 263 4.8e-29 PFAM
low complexity region 668 692 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the importin-beta family of nuclear transport proteins. The encoded protein mediates the import of specific cargo proteins from the cytoplasm to the nucleus and is dependent on the Ras-related nuclear protein-GTPase system. The encoded protein is also involved in nuclear export of the eukaryotic translation initiation factor 1A.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion die prior to genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 A G 9: 54,628,461 I130T possibly damaging Het
Adam24 T A 8: 40,680,000 L169* probably null Het
Als2 A T 1: 59,207,812 I556N probably damaging Het
Ankrd44 A T 1: 54,649,440 N212K Het
Anpep T C 7: 79,840,988 D260G probably benign Het
Arhgap17 A T 7: 123,285,358 probably null Het
Atad2 C T 15: 58,117,293 R383Q probably damaging Het
Atp11b T A 3: 35,819,950 M696K probably benign Het
Atp13a2 A G 4: 140,999,151 T350A probably damaging Het
Atp8b2 T C 3: 89,943,672 D29G possibly damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Cep250 T A 2: 155,973,455 L631* probably null Het
Clec4a3 T C 6: 122,964,292 I82T probably benign Het
Csmd3 T A 15: 47,590,774 I2648F Het
Cul5 A G 9: 53,644,526 F247L probably benign Het
D430042O09Rik T C 7: 125,866,327 V1317A probably benign Het
Dnajc24 A T 2: 105,970,462 M101K probably damaging Het
Dnhd1 T A 7: 105,694,993 V1848E probably damaging Het
Dspp A G 5: 104,174,066 T14A probably benign Het
Fam166a G A 2: 25,220,240 V55I probably damaging Het
Fam196b G T 11: 34,402,359 V134F probably damaging Het
Gm7298 T G 6: 121,785,896 I1392S probably damaging Het
Gm9955 A T 18: 24,709,163 S62R unknown Het
Gtsf1 T G 15: 103,419,961 N130T probably benign Het
Heatr5a C A 12: 51,925,142 S755I probably damaging Het
Hrc A G 7: 45,336,261 T279A possibly damaging Het
Hvcn1 T C 5: 122,233,510 W38R probably damaging Het
Hyal6 A G 6: 24,734,835 S256G probably benign Het
Kif24 A G 4: 41,395,085 V730A probably benign Het
L3mbtl2 T C 15: 81,671,074 V176A probably benign Het
Lgi1 T C 19: 38,306,285 Y502H probably damaging Het
Liph T A 16: 21,976,328 D178V probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mak16 A C 8: 31,166,574 S42A probably benign Het
Mamdc4 T C 2: 25,568,965 I269V probably benign Het
Mapk8ip3 A T 17: 24,901,754 M812K probably benign Het
Muc4 T A 16: 32,752,788 S889T unknown Het
Npy6r A G 18: 44,276,484 N324S probably damaging Het
Ntrk3 T G 7: 78,356,147 T489P possibly damaging Het
Olfr1102 G A 2: 87,002,535 V189I probably benign Het
Olfr187 T A 16: 59,035,933 D268V probably benign Het
Olfr69 G A 7: 103,767,975 Q141* probably null Het
Otof G C 5: 30,383,534 T887S possibly damaging Het
Papola T C 12: 105,807,184 V154A probably damaging Het
Pde4dip T C 3: 97,715,630 H1421R probably benign Het
Plpp5 T C 8: 25,720,579 S66P probably benign Het
Ppp6r3 T A 19: 3,518,337 I154L probably benign Het
Prr18 A C 17: 8,341,909 D299A possibly damaging Het
Psmb1 G A 17: 15,477,259 S198F possibly damaging Het
Qars T C 9: 108,515,123 V723A possibly damaging Het
Rab6a A T 7: 100,636,752 R185* probably null Het
Scn2a C T 2: 65,748,853 Q1511* probably null Het
Serpinb3d T A 1: 107,080,776 I120F possibly damaging Het
Serpini2 T C 3: 75,258,148 T175A probably damaging Het
Skiv2l T C 17: 34,839,464 T1226A probably benign Het
Slc17a6 A G 7: 51,667,511 I427V possibly damaging Het
Slc2a2 C T 3: 28,719,482 A312V possibly damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spcs1 G A 14: 31,000,481 S127F possibly damaging Het
Speg T C 1: 75,422,383 V2158A possibly damaging Het
Sptbn4 T A 7: 27,418,056 I423F probably damaging Het
Synj2 T A 17: 6,026,479 I930N possibly damaging Het
Tas2r140 T A 6: 133,055,660 D45V probably damaging Het
Tcf3 C A 10: 80,421,599 V11F unknown Het
Tead1 A T 7: 112,841,937 Q91L probably benign Het
Tgm5 T A 2: 121,085,768 probably benign Het
Tgoln1 C T 6: 72,616,045 G151S probably benign Het
Tnfrsf11a C A 1: 105,827,539 N445K probably benign Het
Ttn G C 2: 76,710,170 F34157L probably benign Het
Vmn2r91 C A 17: 18,136,162 P697Q probably damaging Het
Zeb2 G A 2: 44,996,994 L684F probably damaging Het
Zfp661 T C 2: 127,577,536 D228G probably benign Het
Zfp738 T C 13: 67,673,028 K77E probably damaging Het
Zkscan1 T A 5: 138,100,930 D378E probably damaging Het
Zswim9 T A 7: 13,259,997 D744V possibly damaging Het
Other mutations in Ipo13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ipo13 APN 4 117903405 missense probably benign 0.10
IGL00800:Ipo13 APN 4 117912308 missense probably benign 0.31
IGL00971:Ipo13 APN 4 117914367 missense possibly damaging 0.83
IGL01552:Ipo13 APN 4 117900964 missense probably benign 0.16
IGL01957:Ipo13 APN 4 117903881 missense probably damaging 0.99
IGL02262:Ipo13 APN 4 117903813 missense probably damaging 1.00
R0109:Ipo13 UTSW 4 117905016 missense possibly damaging 0.92
R0142:Ipo13 UTSW 4 117905569 missense probably damaging 1.00
R0771:Ipo13 UTSW 4 117894646 missense possibly damaging 0.78
R1248:Ipo13 UTSW 4 117901031 missense probably damaging 1.00
R1381:Ipo13 UTSW 4 117904395 missense probably damaging 1.00
R1497:Ipo13 UTSW 4 117904659 missense probably benign 0.04
R1614:Ipo13 UTSW 4 117904618 missense probably benign 0.00
R1711:Ipo13 UTSW 4 117904522 missense probably benign 0.38
R2037:Ipo13 UTSW 4 117904661 nonsense probably null
R2200:Ipo13 UTSW 4 117904903 critical splice donor site probably null
R3698:Ipo13 UTSW 4 117900693 missense probably damaging 1.00
R3949:Ipo13 UTSW 4 117901042 missense probably benign 0.10
R4687:Ipo13 UTSW 4 117901576 missense probably benign 0.06
R4894:Ipo13 UTSW 4 117903441 missense probably damaging 0.99
R4894:Ipo13 UTSW 4 117904490 missense possibly damaging 0.84
R4956:Ipo13 UTSW 4 117901571 missense probably benign 0.00
R5679:Ipo13 UTSW 4 117894832 missense probably damaging 1.00
R5879:Ipo13 UTSW 4 117903203 missense possibly damaging 0.67
R5921:Ipo13 UTSW 4 117912089 missense probably benign 0.14
R6250:Ipo13 UTSW 4 117912154 missense possibly damaging 0.93
R6875:Ipo13 UTSW 4 117904911 missense possibly damaging 0.90
R7412:Ipo13 UTSW 4 117894871 missense probably benign
R7687:Ipo13 UTSW 4 117911891 missense probably benign 0.01
R7774:Ipo13 UTSW 4 117914297 missense probably benign 0.11
Z1088:Ipo13 UTSW 4 117904680 missense probably benign 0.14
Z1176:Ipo13 UTSW 4 117904630 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCACATCCTGAGGGTAGAG -3'
(R):5'- AGTGATGAGGCTCATGCTCG -3'

Sequencing Primer
(F):5'- CACATCCTGAGGGTAGAGAATAAC -3'
(R):5'- GAGCATCACCGCCTTCATG -3'
Posted On2019-06-26