Incidental Mutation 'R7178:Clec4a3'
ID 558762
Institutional Source Beutler Lab
Gene Symbol Clec4a3
Ensembl Gene ENSMUSG00000043832
Gene Name C-type lectin domain family 4, member a3
Synonyms mDcir3, 3110037K17Rik
MMRRC Submission 045232-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7178 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 122929474-122946834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122941251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 82 (I82T)
Ref Sequence ENSEMBL: ENSMUSP00000085816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088468] [ENSMUST00000117173] [ENSMUST00000204427]
AlphaFold Q8JZX6
Predicted Effect probably benign
Transcript: ENSMUST00000088468
AA Change: I82T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000085816
Gene: ENSMUSG00000043832
AA Change: I82T

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 107 231 1.97e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117173
AA Change: I82T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112716
Gene: ENSMUSG00000043832
AA Change: I82T

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 107 231 1.97e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204427
SMART Domains Protein: ENSMUSP00000144856
Gene: ENSMUSG00000043832

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
SCOP:d1e87a_ 71 109 1e-8 SMART
Blast:CLECT 73 109 2e-20 BLAST
PDB:3VYK|A 73 109 7e-13 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 A G 9: 54,535,745 (GRCm39) I130T possibly damaging Het
Adam24 T A 8: 41,133,039 (GRCm39) L169* probably null Het
Als2 A T 1: 59,246,971 (GRCm39) I556N probably damaging Het
Ankrd44 A T 1: 54,688,599 (GRCm39) N212K Het
Anpep T C 7: 79,490,736 (GRCm39) D260G probably benign Het
Arhgap17 A T 7: 122,884,581 (GRCm39) probably null Het
Atad2 C T 15: 57,980,689 (GRCm39) R383Q probably damaging Het
Atp11b T A 3: 35,874,099 (GRCm39) M696K probably benign Het
Atp13a2 A G 4: 140,726,462 (GRCm39) T350A probably damaging Het
Atp8b2 T C 3: 89,850,979 (GRCm39) D29G possibly damaging Het
Baz2a C T 10: 127,960,326 (GRCm39) R1514W probably damaging Het
Cep250 T A 2: 155,815,375 (GRCm39) L631* probably null Het
Cimip2a G A 2: 25,110,252 (GRCm39) V55I probably damaging Het
Csmd3 T A 15: 47,454,170 (GRCm39) I2648F Het
Cul5 A G 9: 53,555,826 (GRCm39) F247L probably benign Het
Dnajc24 A T 2: 105,800,807 (GRCm39) M101K probably damaging Het
Dnhd1 T A 7: 105,344,200 (GRCm39) V1848E probably damaging Het
Dspp A G 5: 104,321,932 (GRCm39) T14A probably benign Het
Gm7298 T G 6: 121,762,855 (GRCm39) I1392S probably damaging Het
Gm9955 A T 18: 24,842,220 (GRCm39) S62R unknown Het
Gtsf1 T G 15: 103,328,388 (GRCm39) N130T probably benign Het
Heatr5a C A 12: 51,971,925 (GRCm39) S755I probably damaging Het
Hrc A G 7: 44,985,685 (GRCm39) T279A possibly damaging Het
Hvcn1 T C 5: 122,371,573 (GRCm39) W38R probably damaging Het
Hyal6 A G 6: 24,734,834 (GRCm39) S256G probably benign Het
Insyn2b G T 11: 34,352,359 (GRCm39) V134F probably damaging Het
Ipo13 A G 4: 117,761,081 (GRCm39) S546P possibly damaging Het
Katnip T C 7: 125,465,499 (GRCm39) V1317A probably benign Het
Kif24 A G 4: 41,395,085 (GRCm39) V730A probably benign Het
L3mbtl2 T C 15: 81,555,275 (GRCm39) V176A probably benign Het
Lgi1 T C 19: 38,294,733 (GRCm39) Y502H probably damaging Het
Liph T A 16: 21,795,078 (GRCm39) D178V probably damaging Het
Maea T C 5: 33,515,854 (GRCm39) V47A probably damaging Het
Mak16 A C 8: 31,656,602 (GRCm39) S42A probably benign Het
Mamdc4 T C 2: 25,458,977 (GRCm39) I269V probably benign Het
Mapk8ip3 A T 17: 25,120,728 (GRCm39) M812K probably benign Het
Muc4 T A 16: 32,752,788 (GRCm38) S889T unknown Het
Npy6r A G 18: 44,409,551 (GRCm39) N324S probably damaging Het
Ntrk3 T G 7: 78,005,895 (GRCm39) T489P possibly damaging Het
Or52a5b G A 7: 103,417,182 (GRCm39) Q141* probably null Het
Or5h19 T A 16: 58,856,296 (GRCm39) D268V probably benign Het
Or5t17 G A 2: 86,832,879 (GRCm39) V189I probably benign Het
Otof G C 5: 30,540,878 (GRCm39) T887S possibly damaging Het
Papola T C 12: 105,773,443 (GRCm39) V154A probably damaging Het
Pde4dip T C 3: 97,622,946 (GRCm39) H1421R probably benign Het
Plpp5 T C 8: 26,210,606 (GRCm39) S66P probably benign Het
Ppp6r3 T A 19: 3,568,337 (GRCm39) I154L probably benign Het
Prr18 A C 17: 8,560,741 (GRCm39) D299A possibly damaging Het
Psmb1 G A 17: 15,697,521 (GRCm39) S198F possibly damaging Het
Qars1 T C 9: 108,392,322 (GRCm39) V723A possibly damaging Het
Rab6a A T 7: 100,285,959 (GRCm39) R185* probably null Het
Scn2a C T 2: 65,579,197 (GRCm39) Q1511* probably null Het
Serpinb3d T A 1: 107,008,506 (GRCm39) I120F possibly damaging Het
Serpini2 T C 3: 75,165,455 (GRCm39) T175A probably damaging Het
Skic2 T C 17: 35,058,440 (GRCm39) T1226A probably benign Het
Slc17a6 A G 7: 51,317,259 (GRCm39) I427V possibly damaging Het
Slc2a2 C T 3: 28,773,631 (GRCm39) A312V possibly damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Spcs1 G A 14: 30,722,438 (GRCm39) S127F possibly damaging Het
Speg T C 1: 75,399,027 (GRCm39) V2158A possibly damaging Het
Sptbn4 T A 7: 27,117,481 (GRCm39) I423F probably damaging Het
Synj2 T A 17: 6,076,754 (GRCm39) I930N possibly damaging Het
Tas2r140 T A 6: 133,032,623 (GRCm39) D45V probably damaging Het
Tcf3 C A 10: 80,257,433 (GRCm39) V11F unknown Het
Tead1 A T 7: 112,441,144 (GRCm39) Q91L probably benign Het
Tgm5 T A 2: 120,916,249 (GRCm39) probably benign Het
Tgoln1 C T 6: 72,593,028 (GRCm39) G151S probably benign Het
Tnfrsf11a C A 1: 105,755,264 (GRCm39) N445K probably benign Het
Ttn G C 2: 76,540,514 (GRCm39) F34157L probably benign Het
Vmn2r91 C A 17: 18,356,424 (GRCm39) P697Q probably damaging Het
Zeb2 G A 2: 44,887,006 (GRCm39) L684F probably damaging Het
Zfp661 T C 2: 127,419,456 (GRCm39) D228G probably benign Het
Zfp738 T C 13: 67,821,147 (GRCm39) K77E probably damaging Het
Zkscan1 T A 5: 138,099,192 (GRCm39) D378E probably damaging Het
Zswim9 T A 7: 12,993,924 (GRCm39) D744V possibly damaging Het
Other mutations in Clec4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Clec4a3 APN 6 122,929,819 (GRCm39) utr 5 prime probably benign
IGL02210:Clec4a3 APN 6 122,931,067 (GRCm39) missense probably damaging 0.98
IGL02874:Clec4a3 APN 6 122,944,519 (GRCm39) missense probably benign 0.16
IGL02983:Clec4a3 APN 6 122,944,526 (GRCm39) critical splice donor site probably null
R0035:Clec4a3 UTSW 6 122,944,508 (GRCm39) missense probably damaging 1.00
R0035:Clec4a3 UTSW 6 122,944,508 (GRCm39) missense probably damaging 1.00
R0334:Clec4a3 UTSW 6 122,946,329 (GRCm39) missense possibly damaging 0.81
R0671:Clec4a3 UTSW 6 122,930,993 (GRCm39) critical splice acceptor site probably null
R1508:Clec4a3 UTSW 6 122,944,467 (GRCm39) missense probably benign 0.05
R1739:Clec4a3 UTSW 6 122,931,000 (GRCm39) nonsense probably null
R3547:Clec4a3 UTSW 6 122,941,239 (GRCm39) missense probably damaging 1.00
R5836:Clec4a3 UTSW 6 122,929,861 (GRCm39) missense possibly damaging 0.66
R5953:Clec4a3 UTSW 6 122,946,451 (GRCm39) missense probably benign 0.12
R7664:Clec4a3 UTSW 6 122,943,381 (GRCm39) missense probably benign 0.03
R7763:Clec4a3 UTSW 6 122,941,299 (GRCm39) missense probably benign 0.01
R8739:Clec4a3 UTSW 6 122,944,508 (GRCm39) missense probably damaging 1.00
R8925:Clec4a3 UTSW 6 122,946,328 (GRCm39) missense probably damaging 1.00
R8927:Clec4a3 UTSW 6 122,946,328 (GRCm39) missense probably damaging 1.00
R8955:Clec4a3 UTSW 6 122,943,479 (GRCm39) missense possibly damaging 0.94
R9457:Clec4a3 UTSW 6 122,931,045 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GGACTATTTCCTAGGCAGGCTC -3'
(R):5'- AATTATGCCTGATTGGAGACCTC -3'

Sequencing Primer
(F):5'- GGCTCTAAACTACTCAGGTACTTGG -3'
(R):5'- TGCCTGATTGGAGACCTCTAAAAAG -3'
Posted On 2019-06-26