Incidental Mutation 'R7178:Mak16'
ID 558776
Institutional Source Beutler Lab
Gene Symbol Mak16
Ensembl Gene ENSMUSG00000031578
Gene Name MAK16 homolog
Synonyms Rbm13, 2600016B03Rik
MMRRC Submission 045232-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R7178 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 31649496-31658752 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 31656602 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 42 (S42A)
Ref Sequence ENSEMBL: ENSMUSP00000033983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033983] [ENSMUST00000098842] [ENSMUST00000209986] [ENSMUST00000210129]
AlphaFold Q8BGS0
Predicted Effect probably benign
Transcript: ENSMUST00000033983
AA Change: S42A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033983
Gene: ENSMUSG00000031578
AA Change: S42A

DomainStartEndE-ValueType
Pfam:Ribosomal_L28e 6 119 5e-40 PFAM
Pfam:Mak16 138 235 4.7e-36 PFAM
low complexity region 242 256 N/A INTRINSIC
low complexity region 258 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098842
SMART Domains Protein: ENSMUSP00000096441
Gene: ENSMUSG00000031577

DomainStartEndE-ValueType
Pfam:DUF2454 208 397 7.1e-17 PFAM
low complexity region 426 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209986
Predicted Effect probably benign
Transcript: ENSMUST00000210129
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 A G 9: 54,535,745 (GRCm39) I130T possibly damaging Het
Adam24 T A 8: 41,133,039 (GRCm39) L169* probably null Het
Als2 A T 1: 59,246,971 (GRCm39) I556N probably damaging Het
Ankrd44 A T 1: 54,688,599 (GRCm39) N212K Het
Anpep T C 7: 79,490,736 (GRCm39) D260G probably benign Het
Arhgap17 A T 7: 122,884,581 (GRCm39) probably null Het
Atad2 C T 15: 57,980,689 (GRCm39) R383Q probably damaging Het
Atp11b T A 3: 35,874,099 (GRCm39) M696K probably benign Het
Atp13a2 A G 4: 140,726,462 (GRCm39) T350A probably damaging Het
Atp8b2 T C 3: 89,850,979 (GRCm39) D29G possibly damaging Het
Baz2a C T 10: 127,960,326 (GRCm39) R1514W probably damaging Het
Cep250 T A 2: 155,815,375 (GRCm39) L631* probably null Het
Cimip2a G A 2: 25,110,252 (GRCm39) V55I probably damaging Het
Clec4a3 T C 6: 122,941,251 (GRCm39) I82T probably benign Het
Csmd3 T A 15: 47,454,170 (GRCm39) I2648F Het
Cul5 A G 9: 53,555,826 (GRCm39) F247L probably benign Het
Dnajc24 A T 2: 105,800,807 (GRCm39) M101K probably damaging Het
Dnhd1 T A 7: 105,344,200 (GRCm39) V1848E probably damaging Het
Dspp A G 5: 104,321,932 (GRCm39) T14A probably benign Het
Gm7298 T G 6: 121,762,855 (GRCm39) I1392S probably damaging Het
Gm9955 A T 18: 24,842,220 (GRCm39) S62R unknown Het
Gtsf1 T G 15: 103,328,388 (GRCm39) N130T probably benign Het
Heatr5a C A 12: 51,971,925 (GRCm39) S755I probably damaging Het
Hrc A G 7: 44,985,685 (GRCm39) T279A possibly damaging Het
Hvcn1 T C 5: 122,371,573 (GRCm39) W38R probably damaging Het
Hyal6 A G 6: 24,734,834 (GRCm39) S256G probably benign Het
Insyn2b G T 11: 34,352,359 (GRCm39) V134F probably damaging Het
Ipo13 A G 4: 117,761,081 (GRCm39) S546P possibly damaging Het
Katnip T C 7: 125,465,499 (GRCm39) V1317A probably benign Het
Kif24 A G 4: 41,395,085 (GRCm39) V730A probably benign Het
L3mbtl2 T C 15: 81,555,275 (GRCm39) V176A probably benign Het
Lgi1 T C 19: 38,294,733 (GRCm39) Y502H probably damaging Het
Liph T A 16: 21,795,078 (GRCm39) D178V probably damaging Het
Maea T C 5: 33,515,854 (GRCm39) V47A probably damaging Het
Mamdc4 T C 2: 25,458,977 (GRCm39) I269V probably benign Het
Mapk8ip3 A T 17: 25,120,728 (GRCm39) M812K probably benign Het
Muc4 T A 16: 32,752,788 (GRCm38) S889T unknown Het
Npy6r A G 18: 44,409,551 (GRCm39) N324S probably damaging Het
Ntrk3 T G 7: 78,005,895 (GRCm39) T489P possibly damaging Het
Or52a5b G A 7: 103,417,182 (GRCm39) Q141* probably null Het
Or5h19 T A 16: 58,856,296 (GRCm39) D268V probably benign Het
Or5t17 G A 2: 86,832,879 (GRCm39) V189I probably benign Het
Otof G C 5: 30,540,878 (GRCm39) T887S possibly damaging Het
Papola T C 12: 105,773,443 (GRCm39) V154A probably damaging Het
Pde4dip T C 3: 97,622,946 (GRCm39) H1421R probably benign Het
Plpp5 T C 8: 26,210,606 (GRCm39) S66P probably benign Het
Ppp6r3 T A 19: 3,568,337 (GRCm39) I154L probably benign Het
Prr18 A C 17: 8,560,741 (GRCm39) D299A possibly damaging Het
Psmb1 G A 17: 15,697,521 (GRCm39) S198F possibly damaging Het
Qars1 T C 9: 108,392,322 (GRCm39) V723A possibly damaging Het
Rab6a A T 7: 100,285,959 (GRCm39) R185* probably null Het
Scn2a C T 2: 65,579,197 (GRCm39) Q1511* probably null Het
Serpinb3d T A 1: 107,008,506 (GRCm39) I120F possibly damaging Het
Serpini2 T C 3: 75,165,455 (GRCm39) T175A probably damaging Het
Skic2 T C 17: 35,058,440 (GRCm39) T1226A probably benign Het
Slc17a6 A G 7: 51,317,259 (GRCm39) I427V possibly damaging Het
Slc2a2 C T 3: 28,773,631 (GRCm39) A312V possibly damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Spcs1 G A 14: 30,722,438 (GRCm39) S127F possibly damaging Het
Speg T C 1: 75,399,027 (GRCm39) V2158A possibly damaging Het
Sptbn4 T A 7: 27,117,481 (GRCm39) I423F probably damaging Het
Synj2 T A 17: 6,076,754 (GRCm39) I930N possibly damaging Het
Tas2r140 T A 6: 133,032,623 (GRCm39) D45V probably damaging Het
Tcf3 C A 10: 80,257,433 (GRCm39) V11F unknown Het
Tead1 A T 7: 112,441,144 (GRCm39) Q91L probably benign Het
Tgm5 T A 2: 120,916,249 (GRCm39) probably benign Het
Tgoln1 C T 6: 72,593,028 (GRCm39) G151S probably benign Het
Tnfrsf11a C A 1: 105,755,264 (GRCm39) N445K probably benign Het
Ttn G C 2: 76,540,514 (GRCm39) F34157L probably benign Het
Vmn2r91 C A 17: 18,356,424 (GRCm39) P697Q probably damaging Het
Zeb2 G A 2: 44,887,006 (GRCm39) L684F probably damaging Het
Zfp661 T C 2: 127,419,456 (GRCm39) D228G probably benign Het
Zfp738 T C 13: 67,821,147 (GRCm39) K77E probably damaging Het
Zkscan1 T A 5: 138,099,192 (GRCm39) D378E probably damaging Het
Zswim9 T A 7: 12,993,924 (GRCm39) D744V possibly damaging Het
Other mutations in Mak16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Mak16 APN 8 31,656,778 (GRCm39) missense probably benign
IGL02071:Mak16 APN 8 31,650,557 (GRCm39) missense probably benign 0.00
IGL02457:Mak16 APN 8 31,654,753 (GRCm39) missense possibly damaging 0.83
IGL02486:Mak16 APN 8 31,650,614 (GRCm39) intron probably benign
FR4342:Mak16 UTSW 8 31,651,777 (GRCm39) missense probably benign 0.00
R4527:Mak16 UTSW 8 31,656,205 (GRCm39) nonsense probably null
R4807:Mak16 UTSW 8 31,656,161 (GRCm39) missense probably benign 0.25
R7315:Mak16 UTSW 8 31,654,766 (GRCm39) nonsense probably null
R7366:Mak16 UTSW 8 31,656,127 (GRCm39) missense possibly damaging 0.88
R8311:Mak16 UTSW 8 31,658,697 (GRCm39) missense probably damaging 1.00
R9387:Mak16 UTSW 8 31,650,794 (GRCm39) missense probably damaging 1.00
R9690:Mak16 UTSW 8 31,650,798 (GRCm39) missense probably damaging 1.00
Z1088:Mak16 UTSW 8 31,656,123 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTACCCGTTCCCAGAGAC -3'
(R):5'- AAAAGGGCTTTCTTTCTGTCTTGC -3'

Sequencing Primer
(F):5'- TGGGAAAAGCTGCTCGC -3'
(R):5'- TGCAGGTAATCTGGAATACACTAG -3'
Posted On 2019-06-26