Mutagenetix > Incidental Mutations

Incidental Mutation 'R7179:Mcm3'

558807

Institutional Source

Beutler Lab

Gene Symbol

Mcm3

Ensembl Gene

ENSMUSG00000041859

Gene Name

minichromosome maintenance complex component 3

Synonyms

P1, p1.m, Mcmd

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7179 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20802968-20820312 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20814857 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 201 (I201T)

Ref Sequence

ENSEMBL: ENSMUSP00000059192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053266]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053266
AA Change: I201T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000059192
Gene: ENSMUSG00000041859
AA Change: I201T

Domain	Start	End	E-Value	Type
MCM	109	654	N/A	SMART
AAA	337	490	1.92e-4	SMART
coiled coil region	655	693	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein is a subunit of the protein complex that consists of MCM2-7. It has been shown to interact directly with MCM5/CDC46. This protein also interacts with and is acetylated by MCM3AP, a chromatin-associated acetyltransferase. The acetylation of this protein inhibits the initiation of DNA replication and cell cycle progression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null or hypomorph alleles exhibit prenatal lethality. Fetal mice homozygous for a hypomorphic allele display anemia and replicative stress during fetal erythropoiesis. Mice heterozygous for null or hypomorph alleles display increased incidence of lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot13	A	T	13: 24,818,171	I96K	probably benign	Het
Adam6a	A	G	12: 113,545,671	T555A	probably benign	Het
Alms1	C	T	6: 85,621,369	P1059L	probably benign	Het
Apol7c	T	C	15: 77,525,643	T368A	probably benign	Het
Arfgef3	A	T	10: 18,599,267	L1557Q	probably damaging	Het
Baz2a	C	T	10: 128,124,457	R1514W	probably damaging	Het
Bmp3	T	A	5: 98,872,763	D348E	probably damaging	Het
Bves	A	G	10: 45,354,817	S295G	probably damaging	Het
Carmil1	A	G	13: 24,020,069	C1328R	probably benign	Het
Ccnk	T	A	12: 108,187,258	Y93N	probably damaging	Het
Ccr1	A	T	9: 123,964,052	V147D	probably damaging	Het
Cd24a	G	A	10: 43,582,640	G36S	probably benign	Het
Cep104	A	G	4: 153,992,867	Y569C	probably damaging	Het
Chd2	A	T	7: 73,475,420	I884N	probably damaging	Het
Cnst	A	T	1: 179,579,382		probably benign	Het
Col22a1	A	G	15: 71,933,413	L146P	unknown	Het
Col25a1	G	T	3: 130,530,119	R321L	probably damaging	Het
Ctnnd2	T	C	15: 30,683,364	Y504H	possibly damaging	Het
D3Ertd751e	C	A	3: 41,748,708	Q73K	probably damaging	Het
Dsc2	C	T	18: 20,035,275		probably null	Het
Eya1	A	T	1: 14,302,852	S14R	probably damaging	Het
Fam131c	A	T	4: 141,383,017		probably null	Het
Fam71a	G	A	1: 191,164,021	R142C	probably damaging	Het
Flvcr2	T	C	12: 85,747,191	F114L	possibly damaging	Het
Fyn	A	G	10: 39,532,124	D321G	possibly damaging	Het
Galnt5	A	C	2: 57,998,609	M74L	probably benign	Het
Gas2l2	G	A	11: 83,422,462	P675S	probably benign	Het
Gm9508	G	T	10: 77,696,636	Q200K	unknown	Het
Greb1l	G	A	18: 10,544,576	S1390N	probably benign	Het
Hdac5	G	T	11: 102,204,559	T430K	possibly damaging	Het
Hjurp	TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT	TCT	1: 88,266,278		probably benign	Het
Khnyn	C	T	14: 55,894,354	P578S	probably damaging	Het
Lepr	A	T	4: 101,745,659	T215S	probably benign	Het
Lrfn5	G	A	12: 61,843,982	V686I	probably benign	Het
Mapkap1	T	A	2: 34,518,700	H233Q	possibly damaging	Het
Metrnl	G	A	11: 121,715,908	R263Q	probably damaging	Het
Mettl22	A	G	16: 8,478,060	E71G	probably benign	Het
Muc16	T	C	9: 18,642,008	T4330A	probably benign	Het
Mug1	A	G	6: 121,857,420	T387A	probably benign	Het
Myh4	A	G	11: 67,244,724	D379G	probably benign	Het
Nbas	A	G	12: 13,405,397	D1204G	possibly damaging	Het
Ncor2	T	C	5: 125,055,783	K478E	unknown	Het
Olfr173	T	A	16: 58,796,887	I320F	probably benign	Het
Olfr294	A	T	7: 86,616,366	L93Q	possibly damaging	Het
Olfr557	A	G	7: 102,698,270	T11A	probably benign	Het
Osbpl7	G	A	11: 97,050,836	V62I	probably benign	Het
Pak1ip1	A	G	13: 41,009,542	N246S	probably damaging	Het
Prim1	A	G	10: 128,015,976	Y39C	probably damaging	Het
Prl3b1	G	T	13: 27,243,844	V46L	probably benign	Het
Prss54	A	T	8: 95,565,571	S127T	probably benign	Het
Rasal3	G	A	17: 32,392,417	T912M	probably damaging	Het
Rrp12	T	A	19: 41,883,778	T420S	probably benign	Het
Rspo1	A	G	4: 125,005,038	N51D	probably damaging	Het
Rufy4	A	G	1: 74,132,876	R253G	probably benign	Het
Scaf1	G	A	7: 45,007,743	R571C	unknown	Het
Scn2a	A	T	2: 65,701,979	H645L	probably damaging	Het
Sec24b	A	G	3: 129,988,946	S1132P	probably damaging	Het
Slc1a2	A	G	2: 102,755,945	K298R	probably damaging	Het
Slc25a54	T	A	3: 109,107,257	N230K	probably benign	Het
Slc27a4	T	G	2: 29,815,652	Y617*	probably null	Het
Slc2a10	T	C	2: 165,515,349	S310P	probably damaging	Het
Snx33	C	T	9: 56,925,867	R306H	probably damaging	Het
Spag9	A	T	11: 94,089,432		probably null	Het
Spg11	A	T	2: 122,101,789		probably null	Het
Sycp2l	A	G	13: 41,129,782	T165A	probably damaging	Het
Syt14	A	G	1: 192,933,263	C189R	probably damaging	Het
Taar9	A	T	10: 24,108,984	L184Q	probably damaging	Het
Tkt	C	T	14: 30,559,858	P111L	probably damaging	Het
Trpc1	A	T	9: 95,721,144	L445Q	possibly damaging	Het
Usp53	A	G	3: 122,949,710	S526P	probably benign	Het
Vps54	T	G	11: 21,298,791	W447G	probably damaging	Het
Xirp2	A	T	2: 67,509,833	H806L	probably benign	Het
Zfp451	A	T	1: 33,802,570	H410Q	unknown	Het
Zfp688	A	G	7: 127,419,312	C214R	probably damaging	Het
Zic4	A	G	9: 91,379,121	D143G	possibly damaging	Het

Other mutations in Mcm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Mcm3	APN	1	20804815	critical splice donor site	probably null
IGL01061:Mcm3	APN	1	20814496	missense	possibly damaging	0.86
IGL01488:Mcm3	APN	1	20813056	missense	possibly damaging	0.90
IGL01609:Mcm3	APN	1	20814680	splice site	probably benign
IGL02483:Mcm3	APN	1	20803572	missense	possibly damaging	0.68
IGL02869:Mcm3	APN	1	20808839	missense	probably damaging	0.99
R0197:Mcm3	UTSW	1	20810105	missense	probably damaging	1.00
R0462:Mcm3	UTSW	1	20805332	missense	probably benign
R0467:Mcm3	UTSW	1	20804847	missense	probably benign
R0669:Mcm3	UTSW	1	20804929	splice site	probably null
R1251:Mcm3	UTSW	1	20812672	nonsense	probably null
R1599:Mcm3	UTSW	1	20820198	missense	probably benign	0.08
R1764:Mcm3	UTSW	1	20805879	missense	probably damaging	0.98
R2015:Mcm3	UTSW	1	20803580	missense	probably damaging	0.98
R2140:Mcm3	UTSW	1	20813110	missense	probably benign	0.00
R3033:Mcm3	UTSW	1	20808768	missense	probably damaging	1.00
R4430:Mcm3	UTSW	1	20811993	nonsense	probably null
R4513:Mcm3	UTSW	1	20810232	missense	probably damaging	1.00
R4563:Mcm3	UTSW	1	20809645	missense	probably benign
R4713:Mcm3	UTSW	1	20803577	missense	probably benign
R4801:Mcm3	UTSW	1	20810156	missense	probably damaging	0.99
R4802:Mcm3	UTSW	1	20810156	missense	probably damaging	0.99
R4896:Mcm3	UTSW	1	20820256	utr 5 prime	probably benign
R5035:Mcm3	UTSW	1	20803418	utr 3 prime	probably benign
R5461:Mcm3	UTSW	1	20814437	missense	probably benign	0.00
R5486:Mcm3	UTSW	1	20814894	missense	probably damaging	1.00
R5531:Mcm3	UTSW	1	20803544	missense	possibly damaging	0.46
R5759:Mcm3	UTSW	1	20808748	frame shift	probably null
R5760:Mcm3	UTSW	1	20808748	frame shift	probably null
R6505:Mcm3	UTSW	1	20803544	missense	probably damaging	1.00
R6833:Mcm3	UTSW	1	20810096	missense	possibly damaging	0.48
R6834:Mcm3	UTSW	1	20810096	missense	possibly damaging	0.48
R7514:Mcm3	UTSW	1	20805896	missense	probably benign	0.19
R7673:Mcm3	UTSW	1	20812014	missense	probably damaging	1.00
R7689:Mcm3	UTSW	1	20806773	missense	probably benign	0.29
R7718:Mcm3	UTSW	1	20817274	nonsense	probably null
R8411:Mcm3	UTSW	1	20816756	missense	probably benign	0.00
R8412:Mcm3	UTSW	1	20816756	missense	probably benign	0.00
R8441:Mcm3	UTSW	1	20814466	missense	probably benign	0.06
X0062:Mcm3	UTSW	1	20820137	missense	possibly damaging	0.49
Z1176:Mcm3	UTSW	1	20820181	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGACGGAATGCCTGTTTGG -3'
(R):5'- TTGAGATAGTCAAGGTTCCAGAAC -3'

Sequencing Primer
(F):5'- GCAGACCCTTTACCTGAAGG -3'
(R):5'- TCAAGGTTCCAGAACGCTAG -3'

Posted On

2019-06-26