Mutagenetix > Incidental Mutation

Incidental Mutation 'R7179:Scn2a'

558817

Institutional Source

Beutler Lab

Gene Symbol

Scn2a

Ensembl Gene

ENSMUSG00000075318

Gene Name

sodium channel, voltage-gated, type II, alpha

Synonyms

A230052E19Rik, Scn2a1, Nav1.2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7179 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65620771-65767447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 65701979 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 645 (H645L)

Ref Sequence

ENSEMBL: ENSMUSP00000028377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]

AlphaFold

B1AWN6

Predicted Effect

probably damaging
Transcript: ENSMUST00000028377
AA Change: H645L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: H645L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	2.2e-81	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	9.6e-83	PFAM
Pfam:Ion_trans	759	994	3.6e-57	PFAM
Pfam:Na_trans_assoc	998	1204	1.7e-63	PFAM
Pfam:Ion_trans	1208	1484	3.3e-66	PFAM
Pfam:Ion_trans	1531	1788	2.8e-57	PFAM
Pfam:PKD_channel	1627	1782	8.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100067
AA Change: H645L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: H645L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	157	424	3.3e-75	PFAM
low complexity region	433	448	N/A	INTRINSIC
low complexity region	450	471	N/A	INTRINSIC
Pfam:DUF3451	488	711	2.6e-66	PFAM
Pfam:Ion_trans	794	983	1.1e-47	PFAM
Pfam:Na_trans_assoc	998	1219	3.5e-77	PFAM
Pfam:Ion_trans	1245	1473	4.4e-55	PFAM
PDB:1BYY\|A	1475	1527	3e-31	PDB
Pfam:Ion_trans	1566	1776	2.4e-52	PFAM
Pfam:PKD_channel	1628	1783	3.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200829
AA Change: H645L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: H645L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	1.2e-79	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	7.1e-80	PFAM
Pfam:Ion_trans	759	994	2.1e-55	PFAM
Pfam:Na_trans_assoc	998	1204	8e-61	PFAM
Pfam:Ion_trans	1208	1484	1.9e-64	PFAM
Pfam:Ion_trans	1531	1788	1.6e-55	PFAM
Pfam:PKD_channel	1627	1782	1.2e-4	PFAM
IQ	1905	1927	1.8e-5	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Meta Mutation Damage Score

0.1192

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot13	A	T	13: 24,818,171	I96K	probably benign	Het
Adam6a	A	G	12: 113,545,671	T555A	probably benign	Het
Alms1	C	T	6: 85,621,369	P1059L	probably benign	Het
Apol7c	T	C	15: 77,525,643	T368A	probably benign	Het
Arfgef3	A	T	10: 18,599,267	L1557Q	probably damaging	Het
Baz2a	C	T	10: 128,124,457	R1514W	probably damaging	Het
Bmp3	T	A	5: 98,872,763	D348E	probably damaging	Het
Bves	A	G	10: 45,354,817	S295G	probably damaging	Het
Carmil1	A	G	13: 24,020,069	C1328R	probably benign	Het
Ccnk	T	A	12: 108,187,258	Y93N	probably damaging	Het
Ccr1	A	T	9: 123,964,052	V147D	probably damaging	Het
Cd24a	G	A	10: 43,582,640	G36S	probably benign	Het
Cep104	A	G	4: 153,992,867	Y569C	probably damaging	Het
Chd2	A	T	7: 73,475,420	I884N	probably damaging	Het
Cnst	A	T	1: 179,579,382		probably benign	Het
Col22a1	A	G	15: 71,933,413	L146P	unknown	Het
Col25a1	G	T	3: 130,530,119	R321L	probably damaging	Het
Ctnnd2	T	C	15: 30,683,364	Y504H	possibly damaging	Het
D3Ertd751e	C	A	3: 41,748,708	Q73K	probably damaging	Het
Dsc2	C	T	18: 20,035,275		probably null	Het
Eya1	A	T	1: 14,302,852	S14R	probably damaging	Het
Fam131c	A	T	4: 141,383,017		probably null	Het
Fam71a	G	A	1: 191,164,021	R142C	probably damaging	Het
Flvcr2	T	C	12: 85,747,191	F114L	possibly damaging	Het
Fyn	A	G	10: 39,532,124	D321G	possibly damaging	Het
Galnt5	A	C	2: 57,998,609	M74L	probably benign	Het
Gas2l2	G	A	11: 83,422,462	P675S	probably benign	Het
Gm9508	G	T	10: 77,696,636	Q200K	unknown	Het
Greb1l	G	A	18: 10,544,576	S1390N	probably benign	Het
Hdac5	G	T	11: 102,204,559	T430K	possibly damaging	Het
Hjurp	TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT	TCT	1: 88,266,278		probably benign	Het
Khnyn	C	T	14: 55,894,354	P578S	probably damaging	Het
Lepr	A	T	4: 101,745,659	T215S	probably benign	Het
Lrfn5	G	A	12: 61,843,982	V686I	probably benign	Het
Mapkap1	T	A	2: 34,518,700	H233Q	possibly damaging	Het
Mcm3	A	G	1: 20,814,857	I201T	probably damaging	Het
Metrnl	G	A	11: 121,715,908	R263Q	probably damaging	Het
Mettl22	A	G	16: 8,478,060	E71G	probably benign	Het
Muc16	T	C	9: 18,642,008	T4330A	probably benign	Het
Mug1	A	G	6: 121,857,420	T387A	probably benign	Het
Myh4	A	G	11: 67,244,724	D379G	probably benign	Het
Nbas	A	G	12: 13,405,397	D1204G	possibly damaging	Het
Ncor2	T	C	5: 125,055,783	K478E	unknown	Het
Olfr173	T	A	16: 58,796,887	I320F	probably benign	Het
Olfr294	A	T	7: 86,616,366	L93Q	possibly damaging	Het
Olfr557	A	G	7: 102,698,270	T11A	probably benign	Het
Osbpl7	G	A	11: 97,050,836	V62I	probably benign	Het
Pak1ip1	A	G	13: 41,009,542	N246S	probably damaging	Het
Prim1	A	G	10: 128,015,976	Y39C	probably damaging	Het
Prl3b1	G	T	13: 27,243,844	V46L	probably benign	Het
Prss54	A	T	8: 95,565,571	S127T	probably benign	Het
Rasal3	G	A	17: 32,392,417	T912M	probably damaging	Het
Rrp12	T	A	19: 41,883,778	T420S	probably benign	Het
Rspo1	A	G	4: 125,005,038	N51D	probably damaging	Het
Rufy4	A	G	1: 74,132,876	R253G	probably benign	Het
Scaf1	G	A	7: 45,007,743	R571C	unknown	Het
Sec24b	A	G	3: 129,988,946	S1132P	probably damaging	Het
Slc1a2	A	G	2: 102,755,945	K298R	probably damaging	Het
Slc25a54	T	A	3: 109,107,257	N230K	probably benign	Het
Slc27a4	T	G	2: 29,815,652	Y617*	probably null	Het
Slc2a10	T	C	2: 165,515,349	S310P	probably damaging	Het
Snx33	C	T	9: 56,925,867	R306H	probably damaging	Het
Spag9	A	T	11: 94,089,432		probably null	Het
Spg11	A	T	2: 122,101,789		probably null	Het
Sycp2l	A	G	13: 41,129,782	T165A	probably damaging	Het
Syt14	A	G	1: 192,933,263	C189R	probably damaging	Het
Taar9	A	T	10: 24,108,984	L184Q	probably damaging	Het
Tkt	C	T	14: 30,559,858	P111L	probably damaging	Het
Trpc1	A	T	9: 95,721,144	L445Q	possibly damaging	Het
Usp53	A	G	3: 122,949,710	S526P	probably benign	Het
Vps54	T	G	11: 21,298,791	W447G	probably damaging	Het
Xirp2	A	T	2: 67,509,833	H806L	probably benign	Het
Zfp451	A	T	1: 33,802,570	H410Q	unknown	Het
Zfp688	A	G	7: 127,419,312	C214R	probably damaging	Het
Zic4	A	G	9: 91,379,121	D143G	possibly damaging	Het

Other mutations in Scn2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Scn2a	APN	2	65764440	missense	probably benign
IGL00159:Scn2a	APN	2	65743090	missense	probably damaging	1.00
IGL00418:Scn2a	APN	2	65764522	missense	probably benign	0.43
IGL00753:Scn2a	APN	2	65683863	missense	possibly damaging	0.66
IGL00770:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00774:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00847:Scn2a	APN	2	65670734	missense	probably damaging	1.00
IGL01155:Scn2a	APN	2	65717748	missense	probably damaging	1.00
IGL01329:Scn2a	APN	2	65717508	missense	probably benign	0.05
IGL01537:Scn2a	APN	2	65715875	missense	probably benign	0.00
IGL01672:Scn2a	APN	2	65751934	missense	probably damaging	1.00
IGL01958:Scn2a	APN	2	65701829	missense	probably damaging	1.00
IGL02028:Scn2a	APN	2	65763658	missense	probably damaging	0.96
IGL02142:Scn2a	APN	2	65715838	missense	probably damaging	1.00
IGL02160:Scn2a	APN	2	65730116	missense	probably damaging	1.00
IGL02183:Scn2a	APN	2	65671603	missense	probably benign	0.20
IGL02341:Scn2a	APN	2	65688377	missense	probably damaging	1.00
IGL02504:Scn2a	APN	2	65683884	missense	probably benign	0.02
IGL02530:Scn2a	APN	2	65730178	missense	probably damaging	0.99
IGL02621:Scn2a	APN	2	65748879	splice site	probably benign
IGL02652:Scn2a	APN	2	65702038	missense	possibly damaging	0.82
IGL02966:Scn2a	APN	2	65701844	missense	possibly damaging	0.93
IGL03188:Scn2a	APN	2	65671653	missense	probably damaging	0.99
IGL03329:Scn2a	APN	2	65764629	missense	probably benign
IGL03336:Scn2a	APN	2	65688744	missense	probably damaging	1.00
IGL03391:Scn2a	APN	2	65764213	missense	probably damaging	1.00
PIT4280001:Scn2a	UTSW	2	65715730	missense	probably damaging	1.00
PIT4362001:Scn2a	UTSW	2	65683838	missense	probably benign	0.09
PIT4403001:Scn2a	UTSW	2	65711908	missense	probably damaging	1.00
PIT4520001:Scn2a	UTSW	2	65688419	missense	probably damaging	1.00
R0021:Scn2a	UTSW	2	65670515	missense	possibly damaging	0.51
R0141:Scn2a	UTSW	2	65711816	missense	probably benign	0.01
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0335:Scn2a	UTSW	2	65682091	missense	probably damaging	1.00
R0508:Scn2a	UTSW	2	65717842	missense	probably damaging	0.99
R0558:Scn2a	UTSW	2	65711925	missense	probably benign	0.26
R0600:Scn2a	UTSW	2	65701833	missense	possibly damaging	0.90
R0667:Scn2a	UTSW	2	65751996	missense	possibly damaging	0.91
R1178:Scn2a	UTSW	2	65686779	splice site	probably benign
R1244:Scn2a	UTSW	2	65763655	missense	probably damaging	0.98
R1386:Scn2a	UTSW	2	65688741	missense	probably damaging	1.00
R1434:Scn2a	UTSW	2	65701991	missense	possibly damaging	0.79
R1440:Scn2a	UTSW	2	65764594	missense	probably benign
R1448:Scn2a	UTSW	2	65683845	missense	probably benign	0.17
R1460:Scn2a	UTSW	2	65701843	missense	probably damaging	0.96
R1553:Scn2a	UTSW	2	65713836	nonsense	probably null
R1642:Scn2a	UTSW	2	65683697	missense	probably damaging	1.00
R1803:Scn2a	UTSW	2	65670767	splice site	probably null
R1981:Scn2a	UTSW	2	65690170	missense	probably damaging	1.00
R2002:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R2068:Scn2a	UTSW	2	65752073	missense	probably benign	0.14
R2125:Scn2a	UTSW	2	65752079	nonsense	probably null
R2126:Scn2a	UTSW	2	65752079	nonsense	probably null
R2876:Scn2a	UTSW	2	65715897	missense	possibly damaging	0.64
R2878:Scn2a	UTSW	2	65688371	missense	probably damaging	1.00
R3113:Scn2a	UTSW	2	65748785	missense	possibly damaging	0.86
R3749:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3750:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3765:Scn2a	UTSW	2	65682710	missense	possibly damaging	0.51
R3850:Scn2a	UTSW	2	65682031	missense	probably benign	0.14
R4585:Scn2a	UTSW	2	65743051	splice site	probably null
R4586:Scn2a	UTSW	2	65743051	splice site	probably null
R4588:Scn2a	UTSW	2	65713767	missense	possibly damaging	0.76
R4622:Scn2a	UTSW	2	65752027	missense	probably benign	0.04
R5108:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R5161:Scn2a	UTSW	2	65764591	missense	probably benign	0.00
R5235:Scn2a	UTSW	2	65752011	missense	probably damaging	1.00
R5464:Scn2a	UTSW	2	65701756	missense	probably damaging	1.00
R5586:Scn2a	UTSW	2	65707295	nonsense	probably null
R5630:Scn2a	UTSW	2	65726365	missense	probably damaging	1.00
R5715:Scn2a	UTSW	2	65717584	missense	probably benign	0.27
R5730:Scn2a	UTSW	2	65682538	nonsense	probably null
R5734:Scn2a	UTSW	2	65717722	missense	possibly damaging	0.49
R5779:Scn2a	UTSW	2	65764483	missense	probably benign	0.00
R6133:Scn2a	UTSW	2	65743104	missense	probably benign	0.35
R6547:Scn2a	UTSW	2	65715897	missense	probably benign	0.29
R6549:Scn2a	UTSW	2	65764674	missense	probably benign	0.05
R6818:Scn2a	UTSW	2	65688669	nonsense	probably null
R6999:Scn2a	UTSW	2	65682109	missense	probably benign
R7069:Scn2a	UTSW	2	65764606	missense	probably benign	0.00
R7073:Scn2a	UTSW	2	65728443	missense	probably benign	0.00
R7125:Scn2a	UTSW	2	65763933	missense	probably damaging	1.00
R7178:Scn2a	UTSW	2	65748853	nonsense	probably null
R7203:Scn2a	UTSW	2	65748319	missense	probably benign	0.01
R7227:Scn2a	UTSW	2	65752023	missense	probably damaging	0.98
R7269:Scn2a	UTSW	2	65763769	missense	probably damaging	1.00
R7358:Scn2a	UTSW	2	65682506	nonsense	probably null
R7388:Scn2a	UTSW	2	65688654	missense	probably damaging	1.00
R7491:Scn2a	UTSW	2	65702008	missense	probably damaging	0.99
R7619:Scn2a	UTSW	2	65715903	missense	probably damaging	1.00
R7695:Scn2a	UTSW	2	65711907	missense	probably damaging	0.99
R7735:Scn2a	UTSW	2	65763669	missense	probably benign	0.40
R7911:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R8096:Scn2a	UTSW	2	65764022	missense	probably damaging	0.98
R8333:Scn2a	UTSW	2	65683847	missense	probably benign	0.01
R8416:Scn2a	UTSW	2	65681001	missense	probably benign	0.00
R8850:Scn2a	UTSW	2	65688386	missense	probably damaging	1.00
R8897:Scn2a	UTSW	2	65715658	critical splice acceptor site	probably null
R8977:Scn2a	UTSW	2	65763670	missense	probably damaging	0.99
R8992:Scn2a	UTSW	2	65763898	missense	probably damaging	1.00
R9190:Scn2a	UTSW	2	65681002	missense	probably benign	0.00
R9206:Scn2a	UTSW	2	65717787	missense	probably damaging	1.00
R9355:Scn2a	UTSW	2	65764089	missense	probably damaging	1.00
R9452:Scn2a	UTSW	2	65764819	missense	probably benign
R9529:Scn2a	UTSW	2	65764588	missense	probably damaging	0.99
R9567:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R9569:Scn2a	UTSW	2	65730278	missense	probably damaging	1.00
R9657:Scn2a	UTSW	2	65735688	missense	probably damaging	1.00
R9715:Scn2a	UTSW	2	65748805	missense	possibly damaging	0.93
R9761:Scn2a	UTSW	2	65735686	missense	probably damaging	1.00
Z1176:Scn2a	UTSW	2	65751868	missense	possibly damaging	0.84
Z1177:Scn2a	UTSW	2	65717735	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- CTTCAAAGGTCGGGTGAAGG -3'
(R):5'- CTTGGCCTGGGAATAAAAGATGC -3'

Sequencing Primer
(F):5'- CTTCAAAGGTCGGGTGAAGGATATTG -3'
(R):5'- AGATGCAGGAAAATTATCATCTGTG -3'

Posted On

2019-06-26