Incidental Mutation 'R7179:Scn2a'
ID558817
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Namesodium channel, voltage-gated, type II, alpha
SynonymsA230052E19Rik, Scn2a1, Nav1.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7179 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location65620771-65767447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65701979 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 645 (H645L)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: H645L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: H645L

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: H645L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: H645L

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: H645L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: H645L

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam131c A T 4: 141,383,017 probably null Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spag9 A T 11: 94,089,432 probably null Het
Spg11 A T 2: 122,101,789 probably null Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65764440 missense probably benign
IGL00159:Scn2a APN 2 65743090 missense probably damaging 1.00
IGL00418:Scn2a APN 2 65764522 missense probably benign 0.43
IGL00753:Scn2a APN 2 65683863 missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00774:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00847:Scn2a APN 2 65670734 missense probably damaging 1.00
IGL01155:Scn2a APN 2 65717748 missense probably damaging 1.00
IGL01329:Scn2a APN 2 65717508 missense probably benign 0.05
IGL01537:Scn2a APN 2 65715875 missense probably benign 0.00
IGL01672:Scn2a APN 2 65751934 missense probably damaging 1.00
IGL01958:Scn2a APN 2 65701829 missense probably damaging 1.00
IGL02028:Scn2a APN 2 65763658 missense probably damaging 0.96
IGL02142:Scn2a APN 2 65715838 missense probably damaging 1.00
IGL02160:Scn2a APN 2 65730116 missense probably damaging 1.00
IGL02183:Scn2a APN 2 65671603 missense probably benign 0.20
IGL02341:Scn2a APN 2 65688377 missense probably damaging 1.00
IGL02504:Scn2a APN 2 65683884 missense probably benign 0.02
IGL02530:Scn2a APN 2 65730178 missense probably damaging 0.99
IGL02621:Scn2a APN 2 65748879 splice site probably benign
IGL02652:Scn2a APN 2 65702038 missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65701844 missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65671653 missense probably damaging 0.99
IGL03329:Scn2a APN 2 65764629 missense probably benign
IGL03336:Scn2a APN 2 65688744 missense probably damaging 1.00
IGL03391:Scn2a APN 2 65764213 missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65715730 missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65683838 missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65711908 missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65688419 missense probably damaging 1.00
R0021:Scn2a UTSW 2 65670515 missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65711816 missense probably benign 0.01
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0335:Scn2a UTSW 2 65682091 missense probably damaging 1.00
R0508:Scn2a UTSW 2 65717842 missense probably damaging 0.99
R0558:Scn2a UTSW 2 65711925 missense probably benign 0.26
R0600:Scn2a UTSW 2 65701833 missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65751996 missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65686779 splice site probably benign
R1244:Scn2a UTSW 2 65763655 missense probably damaging 0.98
R1386:Scn2a UTSW 2 65688741 missense probably damaging 1.00
R1434:Scn2a UTSW 2 65701991 missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65764594 missense probably benign
R1448:Scn2a UTSW 2 65683845 missense probably benign 0.17
R1460:Scn2a UTSW 2 65701843 missense probably damaging 0.96
R1553:Scn2a UTSW 2 65713836 nonsense probably null
R1642:Scn2a UTSW 2 65683697 missense probably damaging 1.00
R1803:Scn2a UTSW 2 65670767 splice site probably null
R1981:Scn2a UTSW 2 65690170 missense probably damaging 1.00
R2002:Scn2a UTSW 2 65682083 missense probably null 1.00
R2068:Scn2a UTSW 2 65752073 missense probably benign 0.14
R2125:Scn2a UTSW 2 65752079 nonsense probably null
R2126:Scn2a UTSW 2 65752079 nonsense probably null
R2876:Scn2a UTSW 2 65715897 missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65688371 missense probably damaging 1.00
R3113:Scn2a UTSW 2 65748785 missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3750:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3765:Scn2a UTSW 2 65682710 missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65682031 missense probably benign 0.14
R4585:Scn2a UTSW 2 65743051 splice site probably null
R4586:Scn2a UTSW 2 65743051 splice site probably null
R4588:Scn2a UTSW 2 65713767 missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65752027 missense probably benign 0.04
R5108:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R5161:Scn2a UTSW 2 65764591 missense probably benign 0.00
R5235:Scn2a UTSW 2 65752011 missense probably damaging 1.00
R5464:Scn2a UTSW 2 65701756 missense probably damaging 1.00
R5586:Scn2a UTSW 2 65707295 nonsense probably null
R5630:Scn2a UTSW 2 65726365 missense probably damaging 1.00
R5715:Scn2a UTSW 2 65717584 missense probably benign 0.27
R5730:Scn2a UTSW 2 65682538 nonsense probably null
R5734:Scn2a UTSW 2 65717722 missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65764483 missense probably benign 0.00
R6133:Scn2a UTSW 2 65743104 missense probably benign 0.35
R6547:Scn2a UTSW 2 65715897 missense probably benign 0.29
R6549:Scn2a UTSW 2 65764674 missense probably benign 0.05
R6818:Scn2a UTSW 2 65688669 nonsense probably null
R6999:Scn2a UTSW 2 65682109 missense probably benign
R7069:Scn2a UTSW 2 65764606 missense probably benign 0.00
R7073:Scn2a UTSW 2 65728443 missense probably benign 0.00
R7125:Scn2a UTSW 2 65763933 missense probably damaging 1.00
R7178:Scn2a UTSW 2 65748853 nonsense probably null
R7203:Scn2a UTSW 2 65748319 missense probably benign 0.01
R7227:Scn2a UTSW 2 65752023 missense probably damaging 0.98
R7269:Scn2a UTSW 2 65763769 missense probably damaging 1.00
R7358:Scn2a UTSW 2 65682506 nonsense probably null
R7388:Scn2a UTSW 2 65688654 missense probably damaging 1.00
R7491:Scn2a UTSW 2 65702008 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCAAAGGTCGGGTGAAGG -3'
(R):5'- CTTGGCCTGGGAATAAAAGATGC -3'

Sequencing Primer
(F):5'- CTTCAAAGGTCGGGTGAAGGATATTG -3'
(R):5'- AGATGCAGGAAAATTATCATCTGTG -3'
Posted On2019-06-26