Incidental Mutation 'R7179:Slc1a2'
ID558819
Institutional Source Beutler Lab
Gene Symbol Slc1a2
Ensembl Gene ENSMUSG00000005089
Gene Namesolute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms2900019G14Rik, 1700091C19Rik, MGLT1, GLT1, Eaat2, GLT-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R7179 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location102658659-102790784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102755945 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 298 (K298R)
Ref Sequence ENSEMBL: ENSMUSP00000079100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005220] [ENSMUST00000080210] [ENSMUST00000111212] [ENSMUST00000111213]
Predicted Effect probably damaging
Transcript: ENSMUST00000005220
AA Change: K295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005220
Gene: ENSMUSG00000005089
AA Change: K295R

DomainStartEndE-ValueType
Pfam:SDF 43 492 8.9e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080210
AA Change: K298R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079100
Gene: ENSMUSG00000005089
AA Change: K298R

DomainStartEndE-ValueType
Pfam:SDF 46 495 3e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111212
AA Change: K295R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106843
Gene: ENSMUSG00000005089
AA Change: K295R

DomainStartEndE-ValueType
Pfam:SDF 43 492 9.5e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111213
AA Change: K298R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106844
Gene: ENSMUSG00000005089
AA Change: K298R

DomainStartEndE-ValueType
Pfam:SDF 46 495 2e-134 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122094
Gene: ENSMUSG00000005089
AA Change: K13R

DomainStartEndE-ValueType
Pfam:SDF 1 144 2.6e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of solute transporter proteins. The membrane-bound protein is the principal transporter that clears the excitatory neurotransmitter glutamate from the extracellular space at synapses in the central nervous system. Glutamate clearance is necessary for proper synaptic activation and to prevent neuronal damage from excessive activation of glutamate receptors. Mutations in and decreased expression of this protein are associated with amyotrophic lateral sclerosis. Alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display spontaneous seizures often leading to death as well as a succeptibility to neuronal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam131c A T 4: 141,383,017 probably null Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spag9 A T 11: 94,089,432 probably null Het
Spg11 A T 2: 122,101,789 probably null Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Slc1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Slc1a2 APN 2 102777576 missense possibly damaging 0.55
IGL00588:Slc1a2 APN 2 102756001 missense probably benign
IGL00931:Slc1a2 APN 2 102756112 missense probably damaging 1.00
IGL00942:Slc1a2 APN 2 102739814 missense probably damaging 1.00
IGL02100:Slc1a2 APN 2 102756089 missense probably damaging 1.00
IGL02173:Slc1a2 APN 2 102743861 missense probably benign 0.05
IGL02184:Slc1a2 APN 2 102748544 missense probably damaging 1.00
IGL02480:Slc1a2 APN 2 102736066 missense probably damaging 1.00
IGL02643:Slc1a2 APN 2 102739880 missense probably benign 0.30
IGL03332:Slc1a2 APN 2 102748534 missense possibly damaging 0.96
R0335:Slc1a2 UTSW 2 102743863 missense probably benign
R0544:Slc1a2 UTSW 2 102756072 missense probably damaging 0.99
R0570:Slc1a2 UTSW 2 102756007 missense probably damaging 1.00
R1472:Slc1a2 UTSW 2 102737909 missense probably damaging 1.00
R1536:Slc1a2 UTSW 2 102777510 missense probably benign 0.37
R1856:Slc1a2 UTSW 2 102777567 missense probably damaging 0.97
R1936:Slc1a2 UTSW 2 102777605 missense probably benign 0.04
R1965:Slc1a2 UTSW 2 102739900 missense probably damaging 1.00
R2270:Slc1a2 UTSW 2 102735994 missense probably damaging 1.00
R2365:Slc1a2 UTSW 2 102748453 intron probably null
R2567:Slc1a2 UTSW 2 102767010 missense probably damaging 1.00
R2878:Slc1a2 UTSW 2 102761167 missense probably damaging 1.00
R3080:Slc1a2 UTSW 2 102748556 missense probably damaging 1.00
R4716:Slc1a2 UTSW 2 102748538 missense probably damaging 0.96
R4744:Slc1a2 UTSW 2 102737869 missense probably benign 0.41
R5197:Slc1a2 UTSW 2 102756115 missense probably benign 0.02
R5835:Slc1a2 UTSW 2 102777450 missense probably damaging 1.00
R7077:Slc1a2 UTSW 2 102777510 missense probably benign 0.37
R7155:Slc1a2 UTSW 2 102766995 missense probably damaging 1.00
R7455:Slc1a2 UTSW 2 102735954 missense probably benign 0.16
R7492:Slc1a2 UTSW 2 102739930 nonsense probably null
R7818:Slc1a2 UTSW 2 102743956 missense probably benign 0.06
R7868:Slc1a2 UTSW 2 102761185 missense probably benign 0.06
R7951:Slc1a2 UTSW 2 102761185 missense probably benign 0.06
X0065:Slc1a2 UTSW 2 102737831 missense probably benign 0.12
Z1177:Slc1a2 UTSW 2 102761125 missense not run
Predicted Primers PCR Primer
(F):5'- GGATCTTGTGTTCTTTCTCAGCAAAAC -3'
(R):5'- AGTTCCCAGAGCAGTGATCC -3'

Sequencing Primer
(F):5'- CTTTCTCAGCAAAACAGAGTGTGTG -3'
(R):5'- CAGAGCAGTGATCCAGGCTTG -3'
Posted On2019-06-26