Incidental Mutation 'R7179:Lepr'
ID558826
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Nameleptin receptor
Synonymsobl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7179 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location101717404-101815352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101745659 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 215 (T215S)
Ref Sequence ENSEMBL: ENSMUSP00000037385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]
Predicted Effect probably benign
Transcript: ENSMUST00000037552
AA Change: T215S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: T215S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102777
AA Change: T215S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: T215S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106921
AA Change: T215S

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: T215S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
Ctnnd2 T C 15: 30,683,364 Y504H possibly damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam131c A T 4: 141,383,017 probably null Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spag9 A T 11: 94,089,432 probably null Het
Spg11 A T 2: 122,101,789 probably null Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
Immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
odd UTSW 4 101728075 splice site probably benign
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 intron probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7023:Lepr UTSW 4 101789287 missense probably damaging 1.00
R7145:Lepr UTSW 4 101752197 missense probably benign 0.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7426:Lepr UTSW 4 101745656 missense probably benign 0.03
R7531:Lepr UTSW 4 101752175 missense probably damaging 1.00
R7620:Lepr UTSW 4 101752073 missense probably benign 0.41
R7804:Lepr UTSW 4 101782586 missense probably damaging 1.00
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AGGGCAGTGGCTTCTCTTTC -3'
(R):5'- TGATCACAGTGATGTAAGCCAG -3'

Sequencing Primer
(F):5'- GCTTATGCTACCTTGACAGTCAG -3'
(R):5'- GTCACTCTGAAGTGCAAC -3'
Posted On2019-06-26