Incidental Mutation 'R0589:Gpx3'
ID55883
Institutional Source Beutler Lab
Gene Symbol Gpx3
Ensembl Gene ENSMUSG00000018339
Gene Nameglutathione peroxidase 3
SynonymsGPx, EGPx, extracellular GPx, plasma GPx
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R0589 (G1)
Quality Score145
Status Validated
Chromosome11
Chromosomal Location54902453-54910377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54909503 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 208 (I208V)
Ref Sequence ENSEMBL: ENSMUSP00000119882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018482] [ENSMUST00000082430] [ENSMUST00000102730] [ENSMUST00000102731] [ENSMUST00000108885] [ENSMUST00000108886] [ENSMUST00000108889] [ENSMUST00000125094] [ENSMUST00000149324]
Predicted Effect probably benign
Transcript: ENSMUST00000018482
SMART Domains Protein: ENSMUSP00000018482
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082430
AA Change: I176V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081011
Gene: ENSMUSG00000018339
AA Change: I176V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 153 4.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102730
SMART Domains Protein: ENSMUSP00000099791
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 3e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102731
SMART Domains Protein: ENSMUSP00000099792
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108885
SMART Domains Protein: ENSMUSP00000104513
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108886
SMART Domains Protein: ENSMUSP00000104514
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108889
SMART Domains Protein: ENSMUSP00000104517
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124304
Predicted Effect probably benign
Transcript: ENSMUST00000125094
AA Change: I176V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119165
Gene: ENSMUSG00000018339
AA Change: I176V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 153 1.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149324
AA Change: I208V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119882
Gene: ENSMUSG00000018339
AA Change: I208V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 83 1e-13 PFAM
Pfam:GSHPx 99 185 7.3e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is secreted and is highly expressed in mouse kidney, which appears to be the major source of the enzyme in plasma. It has a role in mouse organogenesis, and dysregulation of this isozyme has been associated with obesity-related metabolic complications, platelet-dependent thrombosis, colitis-associated carcinoma, and thermosensitive phenotype. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glutathione peroxidase activity, increase plasma selenium levels when mice are fed a selenium supplemented diet, and reduced kidney selenium levels regardless of selenium supplementation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,942,268 A1202E probably damaging Het
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Camk2a G A 18: 60,963,964 probably null Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Grk3 A G 5: 112,928,763 probably benign Het
Heatr9 T C 11: 83,514,690 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Marf1 C A 16: 14,142,055 probably benign Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr1220 A G 2: 89,097,262 F222L probably benign Het
Olfr531 T G 7: 140,400,900 S49R possibly damaging Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Pgbd1 G A 13: 21,434,430 T19I possibly damaging Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trem1 A G 17: 48,237,217 D90G possibly damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Gpx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02125:Gpx3 APN 11 54907242 missense probably damaging 1.00
IGL02600:Gpx3 APN 11 54909607 missense possibly damaging 0.84
R0969:Gpx3 UTSW 11 54909026 splice site probably benign
R1344:Gpx3 UTSW 11 54909596 missense probably damaging 0.99
R1418:Gpx3 UTSW 11 54909596 missense probably damaging 0.99
R5105:Gpx3 UTSW 11 54907154 missense possibly damaging 0.82
R5390:Gpx3 UTSW 11 54909549 missense probably damaging 0.98
R6476:Gpx3 UTSW 11 54907199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCCTTCCAGTCAGCATAGAG -3'
(R):5'- GGAATGTGGCTTCCTTCCTGAAGAG -3'

Sequencing Primer
(F):5'- CTTCCAGTCAGCATAGAGATGGAC -3'
(R):5'- TCGGCCCTTGCATGATG -3'
Posted On2013-07-11