Incidental Mutation 'R0589:Myh8'
ID 55884
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Name myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms Myhsp, MyHC-pn, Myhs-p, 4832426G23Rik
MMRRC Submission 038779-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.826) question?
Stock # R0589 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 67167950-67199460 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67189453 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1210 (I1210V)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
AlphaFold P13542
Predicted Effect probably benign
Transcript: ENSMUST00000019625
AA Change: I1210V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: I1210V

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Meta Mutation Damage Score 0.0837 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,833,094 (GRCm39) A1202E probably damaging Het
Abcc12 A T 8: 87,287,101 (GRCm39) I155N possibly damaging Het
Atf4 T A 15: 80,140,640 (GRCm39) H47Q probably damaging Het
Atm T A 9: 53,401,492 (GRCm39) D1459V possibly damaging Het
Bicral A G 17: 47,112,522 (GRCm39) S893P probably benign Het
Camk2a G A 18: 61,097,036 (GRCm39) probably null Het
Cebpz G A 17: 79,244,308 (GRCm39) T51I probably damaging Het
Cers5 A T 15: 99,638,837 (GRCm39) D208E probably damaging Het
Cimip2b T C 4: 43,427,355 (GRCm39) probably benign Het
Cyp1a2 T C 9: 57,586,345 (GRCm39) D391G possibly damaging Het
Dct G T 14: 118,280,682 (GRCm39) F111L probably benign Het
Ddb1 T G 19: 10,599,080 (GRCm39) I529S probably benign Het
Dhx9 G T 1: 153,348,037 (GRCm39) Q361K probably damaging Het
Dnai3 A G 3: 145,768,086 (GRCm39) S592P probably benign Het
Erbin G T 13: 104,022,795 (GRCm39) R15S probably damaging Het
F13b T C 1: 139,434,671 (GRCm39) S146P possibly damaging Het
Ggnbp2 A T 11: 84,727,277 (GRCm39) C520S probably damaging Het
Gpx3 A G 11: 54,800,329 (GRCm39) I208V probably benign Het
Grk3 A G 5: 113,076,629 (GRCm39) probably benign Het
Heatr9 T C 11: 83,405,516 (GRCm39) probably benign Het
Heg1 T G 16: 33,552,077 (GRCm39) I762R probably damaging Het
Ints11 A T 4: 155,971,343 (GRCm39) T264S probably damaging Het
Ints14 T C 9: 64,887,113 (GRCm39) L348P probably damaging Het
Maco1 C A 4: 134,555,528 (GRCm39) C315F probably benign Het
Marf1 C A 16: 13,959,919 (GRCm39) probably benign Het
Med13 A G 11: 86,174,075 (GRCm39) Y1808H probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Mrpl45 A T 11: 97,214,714 (GRCm39) T134S probably benign Het
Nsd3 T C 8: 26,131,303 (GRCm39) S223P probably damaging Het
Or2j6 T G 7: 139,980,813 (GRCm39) S49R possibly damaging Het
Or4c115 A G 2: 88,927,606 (GRCm39) F222L probably benign Het
Or5be3 A T 2: 86,864,459 (GRCm39) Y35* probably null Het
P3h3 T A 6: 124,818,644 (GRCm39) E731D probably damaging Het
Pcdhac2 A G 18: 37,279,527 (GRCm39) R836G probably benign Het
Pdzd2 A G 15: 12,376,385 (GRCm39) V1250A probably benign Het
Pgbd1 G A 13: 21,618,600 (GRCm39) T19I possibly damaging Het
Phtf2 T A 5: 21,018,249 (GRCm39) R31* probably null Het
Plod2 T A 9: 92,475,799 (GRCm39) V294D probably benign Het
Rassf5 C T 1: 131,172,720 (GRCm39) G50R probably damaging Het
Rexo5 A G 7: 119,444,606 (GRCm39) T694A probably benign Het
Rtcb A C 10: 85,787,315 (GRCm39) S82A probably damaging Het
Rufy4 T C 1: 74,172,042 (GRCm39) L255P probably damaging Het
Slc35c1 A G 2: 92,284,859 (GRCm39) F252L probably damaging Het
Slco6d1 A T 1: 98,427,472 (GRCm39) probably benign Het
Sox10 T G 15: 79,047,485 (GRCm39) probably benign Het
Stard9 A G 2: 120,529,028 (GRCm39) M1762V probably benign Het
Stat3 A T 11: 100,798,909 (GRCm39) Y94N probably damaging Het
Tasor T C 14: 27,183,107 (GRCm39) I522T probably benign Het
Tecta T A 9: 42,256,930 (GRCm39) Y1582F probably benign Het
Tex44 A G 1: 86,355,453 (GRCm39) D454G probably damaging Het
Tle6 A G 10: 81,431,253 (GRCm39) probably benign Het
Tmod2 T C 9: 75,484,041 (GRCm39) E303G probably damaging Het
Trem1 A G 17: 48,544,245 (GRCm39) D90G possibly damaging Het
Trhde A T 10: 114,284,229 (GRCm39) D751E probably benign Het
Ttn A T 2: 76,795,589 (GRCm39) probably null Het
Vars2 T C 17: 35,970,068 (GRCm39) T774A probably benign Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67,174,644 (GRCm39) missense probably damaging 0.97
IGL01020:Myh8 APN 11 67,174,229 (GRCm39) missense probably damaging 0.99
IGL01348:Myh8 APN 11 67,188,606 (GRCm39) missense probably damaging 1.00
IGL01382:Myh8 APN 11 67,192,799 (GRCm39) missense probably damaging 1.00
IGL01454:Myh8 APN 11 67,174,422 (GRCm39) missense probably damaging 1.00
IGL01457:Myh8 APN 11 67,183,505 (GRCm39) missense probably benign 0.00
IGL01472:Myh8 APN 11 67,179,205 (GRCm39) splice site probably benign
IGL01473:Myh8 APN 11 67,192,651 (GRCm39) critical splice donor site probably null
IGL01613:Myh8 APN 11 67,192,536 (GRCm39) missense probably benign 0.11
IGL01763:Myh8 APN 11 67,177,245 (GRCm39) missense probably benign 0.01
IGL01828:Myh8 APN 11 67,194,652 (GRCm39) missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67,180,520 (GRCm39) nonsense probably null
IGL01905:Myh8 APN 11 67,175,477 (GRCm39) missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67,174,198 (GRCm39) unclassified probably benign
IGL02386:Myh8 APN 11 67,185,266 (GRCm39) missense probably damaging 0.99
IGL02449:Myh8 APN 11 67,185,440 (GRCm39) critical splice donor site probably null
IGL02500:Myh8 APN 11 67,196,536 (GRCm39) missense probably benign 0.00
IGL02745:Myh8 APN 11 67,188,327 (GRCm39) missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67,192,418 (GRCm39) splice site probably benign
IGL03063:Myh8 APN 11 67,179,031 (GRCm39) missense probably benign 0.00
IGL03223:Myh8 APN 11 67,174,644 (GRCm39) missense probably damaging 0.97
IGL03336:Myh8 APN 11 67,175,528 (GRCm39) missense probably damaging 1.00
IGL03338:Myh8 APN 11 67,189,172 (GRCm39) missense probably damaging 1.00
IGL03351:Myh8 APN 11 67,194,739 (GRCm39) missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67,185,244 (GRCm39) missense probably damaging 1.00
BB003:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
BB009:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
BB013:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
BB019:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
PIT4354001:Myh8 UTSW 11 67,180,456 (GRCm39) missense probably benign 0.01
R0012:Myh8 UTSW 11 67,190,847 (GRCm39) missense probably benign 0.02
R0016:Myh8 UTSW 11 67,189,351 (GRCm39) missense probably damaging 1.00
R0016:Myh8 UTSW 11 67,189,351 (GRCm39) missense probably damaging 1.00
R0115:Myh8 UTSW 11 67,197,090 (GRCm39) splice site probably benign
R0131:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0131:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0132:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0238:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0238:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0239:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0239:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0393:Myh8 UTSW 11 67,196,843 (GRCm39) splice site probably benign
R0453:Myh8 UTSW 11 67,183,731 (GRCm39) missense probably benign 0.03
R0454:Myh8 UTSW 11 67,194,591 (GRCm39) nonsense probably null
R0466:Myh8 UTSW 11 67,189,405 (GRCm39) missense probably benign 0.01
R0487:Myh8 UTSW 11 67,192,837 (GRCm39) missense probably benign
R0511:Myh8 UTSW 11 67,175,333 (GRCm39) missense probably benign 0.01
R0557:Myh8 UTSW 11 67,192,624 (GRCm39) missense possibly damaging 0.88
R0658:Myh8 UTSW 11 67,175,358 (GRCm39) critical splice donor site probably null
R0782:Myh8 UTSW 11 67,180,580 (GRCm39) missense probably benign 0.16
R0829:Myh8 UTSW 11 67,174,326 (GRCm39) unclassified probably benign
R0845:Myh8 UTSW 11 67,177,090 (GRCm39) missense probably damaging 1.00
R0930:Myh8 UTSW 11 67,196,824 (GRCm39) missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67,188,585 (GRCm39) missense probably damaging 1.00
R1132:Myh8 UTSW 11 67,187,957 (GRCm39) nonsense probably null
R1417:Myh8 UTSW 11 67,197,011 (GRCm39) missense probably damaging 1.00
R1478:Myh8 UTSW 11 67,183,551 (GRCm39) missense probably benign 0.23
R1497:Myh8 UTSW 11 67,180,638 (GRCm39) missense probably benign 0.00
R1605:Myh8 UTSW 11 67,192,497 (GRCm39) missense probably damaging 0.99
R1701:Myh8 UTSW 11 67,170,964 (GRCm39) missense probably damaging 1.00
R1950:Myh8 UTSW 11 67,169,830 (GRCm39) missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67,183,550 (GRCm39) missense probably benign 0.00
R2010:Myh8 UTSW 11 67,187,990 (GRCm39) nonsense probably null
R2095:Myh8 UTSW 11 67,177,050 (GRCm39) missense probably benign 0.00
R2132:Myh8 UTSW 11 67,183,702 (GRCm39) missense probably damaging 1.00
R2152:Myh8 UTSW 11 67,185,295 (GRCm39) missense probably damaging 0.97
R2229:Myh8 UTSW 11 67,199,174 (GRCm39) missense probably damaging 0.98
R2302:Myh8 UTSW 11 67,177,065 (GRCm39) missense probably damaging 1.00
R2364:Myh8 UTSW 11 67,185,344 (GRCm39) missense probably benign 0.03
R2429:Myh8 UTSW 11 67,194,723 (GRCm39) missense probably benign 0.21
R2880:Myh8 UTSW 11 67,188,090 (GRCm39) missense probably damaging 0.97
R3692:Myh8 UTSW 11 67,192,744 (GRCm39) missense probably damaging 0.98
R3756:Myh8 UTSW 11 67,175,443 (GRCm39) unclassified probably benign
R3924:Myh8 UTSW 11 67,187,963 (GRCm39) missense probably damaging 0.99
R4172:Myh8 UTSW 11 67,183,247 (GRCm39) missense probably damaging 1.00
R4255:Myh8 UTSW 11 67,190,560 (GRCm39) missense probably benign
R4621:Myh8 UTSW 11 67,177,084 (GRCm39) missense probably damaging 1.00
R4623:Myh8 UTSW 11 67,177,084 (GRCm39) missense probably damaging 1.00
R4790:Myh8 UTSW 11 67,170,789 (GRCm39) missense probably damaging 0.99
R4914:Myh8 UTSW 11 67,183,510 (GRCm39) missense probably damaging 1.00
R5074:Myh8 UTSW 11 67,196,742 (GRCm39) missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67,189,184 (GRCm39) missense probably damaging 1.00
R5159:Myh8 UTSW 11 67,179,179 (GRCm39) missense probably damaging 0.99
R5229:Myh8 UTSW 11 67,175,310 (GRCm39) missense probably damaging 0.96
R5320:Myh8 UTSW 11 67,177,089 (GRCm39) missense probably damaging 1.00
R5455:Myh8 UTSW 11 67,192,244 (GRCm39) missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67,196,788 (GRCm39) missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67,177,266 (GRCm39) missense probably benign 0.00
R5726:Myh8 UTSW 11 67,185,392 (GRCm39) missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67,188,026 (GRCm39) missense probably damaging 1.00
R6135:Myh8 UTSW 11 67,188,326 (GRCm39) missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67,192,793 (GRCm39) missense probably benign 0.06
R6318:Myh8 UTSW 11 67,190,167 (GRCm39) missense probably benign 0.00
R6432:Myh8 UTSW 11 67,189,405 (GRCm39) missense probably benign 0.01
R6452:Myh8 UTSW 11 67,196,565 (GRCm39) missense possibly damaging 0.88
R6452:Myh8 UTSW 11 67,183,275 (GRCm39) missense probably benign 0.27
R6512:Myh8 UTSW 11 67,180,488 (GRCm39) nonsense probably null
R6714:Myh8 UTSW 11 67,197,775 (GRCm39) missense probably damaging 1.00
R6842:Myh8 UTSW 11 67,175,481 (GRCm39) missense probably damaging 1.00
R7007:Myh8 UTSW 11 67,179,142 (GRCm39) missense probably benign 0.03
R7025:Myh8 UTSW 11 67,188,365 (GRCm39) missense probably benign 0.02
R7086:Myh8 UTSW 11 67,183,453 (GRCm39) splice site probably null
R7098:Myh8 UTSW 11 67,169,879 (GRCm39) missense probably benign 0.03
R7498:Myh8 UTSW 11 67,174,263 (GRCm39) missense possibly damaging 0.80
R7716:Myh8 UTSW 11 67,189,478 (GRCm39) missense possibly damaging 0.51
R7765:Myh8 UTSW 11 67,194,481 (GRCm39) missense probably benign 0.44
R7825:Myh8 UTSW 11 67,194,538 (GRCm39) missense possibly damaging 0.94
R7921:Myh8 UTSW 11 67,174,644 (GRCm39) missense probably damaging 0.97
R7926:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
R7932:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
R8003:Myh8 UTSW 11 67,190,586 (GRCm39) missense probably damaging 1.00
R8028:Myh8 UTSW 11 67,194,502 (GRCm39) missense possibly damaging 0.65
R8121:Myh8 UTSW 11 67,180,647 (GRCm39) missense probably benign 0.00
R8125:Myh8 UTSW 11 67,190,598 (GRCm39) missense possibly damaging 0.94
R8170:Myh8 UTSW 11 67,179,092 (GRCm39) missense probably benign 0.30
R8277:Myh8 UTSW 11 67,183,735 (GRCm39) missense probably benign 0.10
R8304:Myh8 UTSW 11 67,195,162 (GRCm39) missense possibly damaging 0.72
R8431:Myh8 UTSW 11 67,174,440 (GRCm39) missense possibly damaging 0.94
R8535:Myh8 UTSW 11 67,169,741 (GRCm39) missense probably damaging 1.00
R8795:Myh8 UTSW 11 67,174,203 (GRCm39) critical splice acceptor site probably benign
R8858:Myh8 UTSW 11 67,192,820 (GRCm39) missense possibly damaging 0.67
R8927:Myh8 UTSW 11 67,174,081 (GRCm39) missense probably benign 0.10
R8928:Myh8 UTSW 11 67,174,081 (GRCm39) missense probably benign 0.10
R9031:Myh8 UTSW 11 67,190,141 (GRCm39) missense possibly damaging 0.49
R9172:Myh8 UTSW 11 67,183,260 (GRCm39) missense possibly damaging 0.82
R9252:Myh8 UTSW 11 67,177,302 (GRCm39) missense probably damaging 1.00
R9365:Myh8 UTSW 11 67,174,632 (GRCm39) missense probably benign 0.42
R9468:Myh8 UTSW 11 67,197,730 (GRCm39) missense probably damaging 1.00
R9564:Myh8 UTSW 11 67,177,215 (GRCm39) missense probably benign 0.40
R9565:Myh8 UTSW 11 67,177,215 (GRCm39) missense probably benign 0.40
T0722:Myh8 UTSW 11 67,195,262 (GRCm39) missense probably benign 0.41
Z1088:Myh8 UTSW 11 67,189,418 (GRCm39) missense probably damaging 1.00
Z1176:Myh8 UTSW 11 67,194,500 (GRCm39) missense probably damaging 1.00
Z1177:Myh8 UTSW 11 67,199,181 (GRCm39) missense possibly damaging 0.64
Z1177:Myh8 UTSW 11 67,192,250 (GRCm39) missense probably damaging 0.99
Z1187:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1188:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1190:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1191:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTACGCGGTTGATTCCCAGG -3'
(R):5'- CCAGGTGTGATACCAGGAACAATGG -3'

Sequencing Primer
(F):5'- CTCCAGGGCCAAAGCAGAG -3'
(R):5'- GAACAATGGATACTGTTTTTCTGGC -3'
Posted On 2013-07-11