Incidental Mutation 'R0589:Heatr9'
ID55885
Institutional Source Beutler Lab
Gene Symbol Heatr9
Ensembl Gene ENSMUSG00000018925
Gene NameHEAT repeat containing 9
SynonymsGm11435
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0589 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83511736-83522175 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 83514690 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019069]
Predicted Effect probably benign
Transcript: ENSMUST00000019069
SMART Domains Protein: ENSMUSP00000019069
Gene: ENSMUSG00000018925

DomainStartEndE-ValueType
SCOP:d1gw5a_ 111 461 2e-13 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,942,268 A1202E probably damaging Het
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Camk2a G A 18: 60,963,964 probably null Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Gpx3 A G 11: 54,909,503 I208V probably benign Het
Grk3 A G 5: 112,928,763 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Marf1 C A 16: 14,142,055 probably benign Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr1220 A G 2: 89,097,262 F222L probably benign Het
Olfr531 T G 7: 140,400,900 S49R possibly damaging Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Pgbd1 G A 13: 21,434,430 T19I possibly damaging Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trem1 A G 17: 48,237,217 D90G possibly damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Heatr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Heatr9 APN 11 83518825 missense probably benign 0.00
IGL02832:Heatr9 APN 11 83518846 splice site probably benign
IGL03325:Heatr9 APN 11 83513259 splice site probably null
R0084:Heatr9 UTSW 11 83512895 splice site probably benign
R0243:Heatr9 UTSW 11 83513338 missense possibly damaging 0.69
R0326:Heatr9 UTSW 11 83514539 missense probably damaging 1.00
R1386:Heatr9 UTSW 11 83518825 missense probably benign 0.00
R1914:Heatr9 UTSW 11 83518209 missense possibly damaging 0.74
R1915:Heatr9 UTSW 11 83518209 missense possibly damaging 0.74
R4078:Heatr9 UTSW 11 83512428 missense probably benign 0.24
R4756:Heatr9 UTSW 11 83516649 missense probably damaging 1.00
R4789:Heatr9 UTSW 11 83519192 missense probably benign 0.06
R4999:Heatr9 UTSW 11 83518792 missense possibly damaging 0.93
R5060:Heatr9 UTSW 11 83512432 missense probably benign 0.20
R5506:Heatr9 UTSW 11 83514766 missense possibly damaging 0.86
R5874:Heatr9 UTSW 11 83514600 missense probably benign 0.36
R5922:Heatr9 UTSW 11 83512367 critical splice donor site probably null
R6322:Heatr9 UTSW 11 83516712 missense possibly damaging 0.51
R7007:Heatr9 UTSW 11 83520620 missense possibly damaging 0.85
R7431:Heatr9 UTSW 11 83519268 missense probably damaging 1.00
R7790:Heatr9 UTSW 11 83518193 missense probably damaging 1.00
R7911:Heatr9 UTSW 11 83512408 missense probably damaging 1.00
R8154:Heatr9 UTSW 11 83511877 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GTAGGGTTTGTTGGGAATCCCCATC -3'
(R):5'- TCCACTTGTGCTCTCATTCCAAAGG -3'

Sequencing Primer
(F):5'- GTTGGGAATCCCCATCTCAAGAG -3'
(R):5'- TCATTCCAAAGGCCAAGAGG -3'
Posted On2013-07-11