Mutagenetix > Incidental Mutation

Incidental Mutation 'R7179:Nbas'

558858

Institutional Source

Beutler Lab

Gene Symbol

Nbas

Ensembl Gene

ENSMUSG00000020576

Gene Name

neuroblastoma amplified sequence

Synonyms

4933425L03Rik

MMRRC Submission

045269-MU

Accession Numbers

Genbank: NM_027706.1; Ensembl: ENSMUST00000042953

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7179 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13269133-13583811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 13405397 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1204 (D1204G)

Ref Sequence

ENSEMBL: ENSMUSP00000036082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042953]

AlphaFold

E9Q411

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042953
AA Change: D1204G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: D1204G

Domain	Start	End	E-Value	Type
Pfam:Nbas_N	89	370	4.7e-171	PFAM
low complexity region	463	475	N/A	INTRINSIC
low complexity region	653	667	N/A	INTRINSIC
Pfam:Sec39	725	1375	3.8e-34	PFAM
low complexity region	1392	1404	N/A	INTRINSIC
low complexity region	1549	1566	N/A	INTRINSIC
low complexity region	2226	2252	N/A	INTRINSIC
low complexity region	2275	2285	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]

Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot13	A	T	13: 24,818,171	I96K	probably benign	Het
Adam6a	A	G	12: 113,545,671	T555A	probably benign	Het
Alms1	C	T	6: 85,621,369	P1059L	probably benign	Het
Apol7c	T	C	15: 77,525,643	T368A	probably benign	Het
Arfgef3	A	T	10: 18,599,267	L1557Q	probably damaging	Het
Baz2a	C	T	10: 128,124,457	R1514W	probably damaging	Het
Bmp3	T	A	5: 98,872,763	D348E	probably damaging	Het
Bves	A	G	10: 45,354,817	S295G	probably damaging	Het
Carmil1	A	G	13: 24,020,069	C1328R	probably benign	Het
Ccnk	T	A	12: 108,187,258	Y93N	probably damaging	Het
Ccr1	A	T	9: 123,964,052	V147D	probably damaging	Het
Cd24a	G	A	10: 43,582,640	G36S	probably benign	Het
Cep104	A	G	4: 153,992,867	Y569C	probably damaging	Het
Chd2	A	T	7: 73,475,420	I884N	probably damaging	Het
Cnst	A	T	1: 179,579,382		probably benign	Het
Col22a1	A	G	15: 71,933,413	L146P	unknown	Het
Col25a1	G	T	3: 130,530,119	R321L	probably damaging	Het
Ctnnd2	T	C	15: 30,683,364	Y504H	possibly damaging	Het
D3Ertd751e	C	A	3: 41,748,708	Q73K	probably damaging	Het
Dsc2	C	T	18: 20,035,275		probably null	Het
Eya1	A	T	1: 14,302,852	S14R	probably damaging	Het
Fam131c	A	T	4: 141,383,017		probably null	Het
Fam71a	G	A	1: 191,164,021	R142C	probably damaging	Het
Flvcr2	T	C	12: 85,747,191	F114L	possibly damaging	Het
Fyn	A	G	10: 39,532,124	D321G	possibly damaging	Het
Galnt5	A	C	2: 57,998,609	M74L	probably benign	Het
Gas2l2	G	A	11: 83,422,462	P675S	probably benign	Het
Gm9508	G	T	10: 77,696,636	Q200K	unknown	Het
Greb1l	G	A	18: 10,544,576	S1390N	probably benign	Het
Hdac5	G	T	11: 102,204,559	T430K	possibly damaging	Het
Hjurp	TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT	TCT	1: 88,266,278		probably benign	Het
Khnyn	C	T	14: 55,894,354	P578S	probably damaging	Het
Lepr	A	T	4: 101,745,659	T215S	probably benign	Het
Lrfn5	G	A	12: 61,843,982	V686I	probably benign	Het
Mapkap1	T	A	2: 34,518,700	H233Q	possibly damaging	Het
Mcm3	A	G	1: 20,814,857	I201T	probably damaging	Het
Metrnl	G	A	11: 121,715,908	R263Q	probably damaging	Het
Mettl22	A	G	16: 8,478,060	E71G	probably benign	Het
Muc16	T	C	9: 18,642,008	T4330A	probably benign	Het
Mug1	A	G	6: 121,857,420	T387A	probably benign	Het
Myh4	A	G	11: 67,244,724	D379G	probably benign	Het
Ncor2	T	C	5: 125,055,783	K478E	unknown	Het
Olfr173	T	A	16: 58,796,887	I320F	probably benign	Het
Olfr294	A	T	7: 86,616,366	L93Q	possibly damaging	Het
Olfr557	A	G	7: 102,698,270	T11A	probably benign	Het
Osbpl7	G	A	11: 97,050,836	V62I	probably benign	Het
Pak1ip1	A	G	13: 41,009,542	N246S	probably damaging	Het
Prim1	A	G	10: 128,015,976	Y39C	probably damaging	Het
Prl3b1	G	T	13: 27,243,844	V46L	probably benign	Het
Prss54	A	T	8: 95,565,571	S127T	probably benign	Het
Rasal3	G	A	17: 32,392,417	T912M	probably damaging	Het
Rrp12	T	A	19: 41,883,778	T420S	probably benign	Het
Rspo1	A	G	4: 125,005,038	N51D	probably damaging	Het
Rufy4	A	G	1: 74,132,876	R253G	probably benign	Het
Scaf1	G	A	7: 45,007,743	R571C	unknown	Het
Scn2a	A	T	2: 65,701,979	H645L	probably damaging	Het
Sec24b	A	G	3: 129,988,946	S1132P	probably damaging	Het
Slc1a2	A	G	2: 102,755,945	K298R	probably damaging	Het
Slc25a54	T	A	3: 109,107,257	N230K	probably benign	Het
Slc27a4	T	G	2: 29,815,652	Y617*	probably null	Het
Slc2a10	T	C	2: 165,515,349	S310P	probably damaging	Het
Snx33	C	T	9: 56,925,867	R306H	probably damaging	Het
Spag9	A	T	11: 94,089,432		probably null	Het
Spg11	A	T	2: 122,101,789		probably null	Het
Sycp2l	A	G	13: 41,129,782	T165A	probably damaging	Het
Syt14	A	G	1: 192,933,263	C189R	probably damaging	Het
Taar9	A	T	10: 24,108,984	L184Q	probably damaging	Het
Tkt	C	T	14: 30,559,858	P111L	probably damaging	Het
Trpc1	A	T	9: 95,721,144	L445Q	possibly damaging	Het
Usp53	A	G	3: 122,949,710	S526P	probably benign	Het
Vps54	T	G	11: 21,298,791	W447G	probably damaging	Het
Xirp2	A	T	2: 67,509,833	H806L	probably benign	Het
Zfp451	A	T	1: 33,802,570	H410Q	unknown	Het
Zfp688	A	G	7: 127,419,312	C214R	probably damaging	Het
Zic4	A	G	9: 91,379,121	D143G	possibly damaging	Het

Other mutations in Nbas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Nbas	APN	12	13453075	missense	probably benign	0.19
IGL00712:Nbas	APN	12	13362625	splice site	probably benign
IGL00808:Nbas	APN	12	13566120	splice site	probably benign
IGL00915:Nbas	APN	12	13374752	nonsense	probably null
IGL00923:Nbas	APN	12	13336284	missense	possibly damaging	0.46
IGL01152:Nbas	APN	12	13360958	missense	probably damaging	1.00
IGL01633:Nbas	APN	12	13483897	missense	probably damaging	1.00
IGL01672:Nbas	APN	12	13379649	missense	possibly damaging	0.63
IGL01799:Nbas	APN	12	13324400	splice site	probably benign
IGL01812:Nbas	APN	12	13453503	missense	probably damaging	1.00
IGL01934:Nbas	APN	12	13289879	splice site	probably benign
IGL02093:Nbas	APN	12	13560962	missense	probably benign	0.00
IGL02115:Nbas	APN	12	13317692	splice site	probably benign
IGL02175:Nbas	APN	12	13566259	critical splice donor site	probably null
IGL02268:Nbas	APN	12	13405397	missense	possibly damaging	0.94
IGL02483:Nbas	APN	12	13324294	missense	probably damaging	1.00
IGL02539:Nbas	APN	12	13272703	splice site	probably benign
IGL02557:Nbas	APN	12	13361028	missense	probably damaging	1.00
IGL02815:Nbas	APN	12	13310266	missense	probably damaging	1.00
IGL02951:Nbas	APN	12	13362541	missense	probably benign
IGL03131:Nbas	APN	12	13279416	missense	probably benign	0.03
IGL03214:Nbas	APN	12	13331110	splice site	probably benign
IGL03308:Nbas	APN	12	13324348	missense	possibly damaging	0.93
IGL03368:Nbas	APN	12	13328451	missense	probably benign	0.08
IGL03372:Nbas	APN	12	13534472	missense	probably damaging	1.00
IGL03391:Nbas	APN	12	13483749	missense	probably benign	0.28
medvedev	UTSW	12	13534577	critical splice donor site	probably null
oligarchs	UTSW	12	13520750	missense	possibly damaging	0.75
putin	UTSW	12	13321755	missense	probably damaging	1.00
1mM(1):Nbas	UTSW	12	13288728	missense	probably damaging	1.00
R0057:Nbas	UTSW	12	13390957	missense	probably benign	0.00
R0076:Nbas	UTSW	12	13324336	missense	probably damaging	1.00
R0153:Nbas	UTSW	12	13273876	splice site	probably benign
R0371:Nbas	UTSW	12	13331095	missense	probably damaging	0.97
R0449:Nbas	UTSW	12	13519108	missense	probably benign	0.18
R0791:Nbas	UTSW	12	13482633	missense	probably benign	0.28
R0931:Nbas	UTSW	12	13331114	splice site	probably benign
R1236:Nbas	UTSW	12	13269241	missense	probably damaging	1.00
R1371:Nbas	UTSW	12	13482378	splice site	probably benign
R1567:Nbas	UTSW	12	13285278	missense	possibly damaging	0.70
R1587:Nbas	UTSW	12	13558685	missense	probably benign
R1719:Nbas	UTSW	12	13560977	critical splice donor site	probably null
R1747:Nbas	UTSW	12	13335898	missense	probably benign	0.00
R1777:Nbas	UTSW	12	13513562	missense	probably benign	0.16
R1848:Nbas	UTSW	12	13413597	missense	probably damaging	0.97
R1856:Nbas	UTSW	12	13474229	missense	possibly damaging	0.56
R1891:Nbas	UTSW	12	13390972	missense	possibly damaging	0.92
R1911:Nbas	UTSW	12	13566144	missense	probably benign
R1912:Nbas	UTSW	12	13566144	missense	probably benign
R2006:Nbas	UTSW	12	13414741	splice site	probably null
R2054:Nbas	UTSW	12	13474206	missense	probably benign	0.36
R2065:Nbas	UTSW	12	13566157	missense	probably damaging	1.00
R2089:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2091:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2091:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2156:Nbas	UTSW	12	13441509	missense	probably damaging	1.00
R2164:Nbas	UTSW	12	13330646	missense	possibly damaging	0.74
R2339:Nbas	UTSW	12	13362592	missense	probably benign	0.12
R2398:Nbas	UTSW	12	13432945	missense	probably damaging	0.99
R3806:Nbas	UTSW	12	13482504	missense	probably damaging	1.00
R3855:Nbas	UTSW	12	13279414	missense	possibly damaging	0.50
R4019:Nbas	UTSW	12	13482519	missense	probably damaging	1.00
R4083:Nbas	UTSW	12	13474191	missense	probably damaging	0.96
R4201:Nbas	UTSW	12	13374826	missense	probably benign	0.00
R4231:Nbas	UTSW	12	13393343	missense	probably damaging	0.98
R4552:Nbas	UTSW	12	13335937	critical splice donor site	probably null
R4560:Nbas	UTSW	12	13583527	missense	probably benign	0.00
R4728:Nbas	UTSW	12	13288739	missense	probably damaging	0.98
R4752:Nbas	UTSW	12	13482537	missense	possibly damaging	0.92
R4832:Nbas	UTSW	12	13483739	missense	probably benign	0.00
R4874:Nbas	UTSW	12	13321755	missense	probably damaging	1.00
R4988:Nbas	UTSW	12	13408265	missense	probably benign	0.45
R5020:Nbas	UTSW	12	13374712	missense	probably damaging	0.99
R5079:Nbas	UTSW	12	13374711	missense	probably damaging	1.00
R5129:Nbas	UTSW	12	13390960	missense	probably damaging	1.00
R5239:Nbas	UTSW	12	13441518	missense	probably benign	0.31
R5299:Nbas	UTSW	12	13441925	nonsense	probably null
R5351:Nbas	UTSW	12	13560849	missense	probably damaging	1.00
R5389:Nbas	UTSW	12	13534577	critical splice donor site	probably null
R5436:Nbas	UTSW	12	13374811	missense	probably damaging	1.00
R5654:Nbas	UTSW	12	13583475	missense	probably damaging	1.00
R5690:Nbas	UTSW	12	13336284	missense	probably damaging	1.00
R5842:Nbas	UTSW	12	13269266	critical splice donor site	probably null
R5959:Nbas	UTSW	12	13288801	missense	probably damaging	0.99
R5982:Nbas	UTSW	12	13393430	missense	probably benign	0.00
R6238:Nbas	UTSW	12	13482595	missense	probably benign
R6270:Nbas	UTSW	12	13324293	missense	probably damaging	1.00
R6363:Nbas	UTSW	12	13482576	missense	probably benign
R6424:Nbas	UTSW	12	13415733	critical splice donor site	probably null
R6458:Nbas	UTSW	12	13288749	missense	probably damaging	1.00
R6526:Nbas	UTSW	12	13405425	missense	probably damaging	1.00
R6654:Nbas	UTSW	12	13483874	nonsense	probably null
R7085:Nbas	UTSW	12	13285258	missense	probably damaging	1.00
R7197:Nbas	UTSW	12	13520750	missense	possibly damaging	0.75
R7378:Nbas	UTSW	12	13274219	missense	probably damaging	1.00
R7393:Nbas	UTSW	12	13393492	missense	probably damaging	1.00
R7425:Nbas	UTSW	12	13469880	missense	probably damaging	1.00
R7446:Nbas	UTSW	12	13393498	missense	probably benign	0.02
R7481:Nbas	UTSW	12	13356959	missense	probably damaging	0.97
R7535:Nbas	UTSW	12	13279389	missense	probably damaging	0.97
R7626:Nbas	UTSW	12	13558660	missense	probably benign	0.00
R7678:Nbas	UTSW	12	13415661	missense	probably damaging	0.97
R7912:Nbas	UTSW	12	13405457	missense	possibly damaging	0.91
R7964:Nbas	UTSW	12	13356895	missense	probably damaging	0.99
R8193:Nbas	UTSW	12	13433009	missense	probably damaging	1.00
R8325:Nbas	UTSW	12	13288795	missense	probably damaging	1.00
R8405:Nbas	UTSW	12	13279393	missense	probably damaging	1.00
R8437:Nbas	UTSW	12	13566250	missense	possibly damaging	0.46
R8559:Nbas	UTSW	12	13352808	missense	probably benign	0.00
R8684:Nbas	UTSW	12	13336367	missense	probably damaging	1.00
R8826:Nbas	UTSW	12	13352874	splice site	probably benign
R8921:Nbas	UTSW	12	13413589	missense	probably benign
R8956:Nbas	UTSW	12	13432922	missense	possibly damaging	0.51
R9083:Nbas	UTSW	12	13335855	missense	possibly damaging	0.56
R9172:Nbas	UTSW	12	13374750	missense	possibly damaging	0.65
R9430:Nbas	UTSW	12	13321653	missense	probably benign	0.35
R9627:Nbas	UTSW	12	13300202	missense	possibly damaging	0.76
R9649:Nbas	UTSW	12	13583416	missense	probably damaging	1.00
RF013:Nbas	UTSW	12	13279408	missense	possibly damaging	0.54
T0722:Nbas	UTSW	12	13352808	missense	probably benign	0.00
Z1176:Nbas	UTSW	12	13483876	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ATCACACCTGGGACCATTGG -3'
(R):5'- TAGGAAATTCTCTGAGAATCTGAGG -3'

Sequencing Primer
(F):5'- GACCATTGGCACCTGTCACTG -3'
(R):5'- GGCAATAGAGTCTATTACTAATG -3'

Posted On

2019-06-26