Incidental Mutation 'R7179:Ctnnd2'
ID558870
Institutional Source Beutler Lab
Gene Symbol Ctnnd2
Ensembl Gene ENSMUSG00000022240
Gene Namecatenin (cadherin associated protein), delta 2
SynonymsCatnd2, neurojugin, Nprap
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_008729.2; MGI:1195966

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7179 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location30172593-31029341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30683364 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 504 (Y504H)
Ref Sequence ENSEMBL: ENSMUSP00000080427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081728] [ENSMUST00000226119]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081728
AA Change: Y504H

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080427
Gene: ENSMUSG00000022240
AA Change: Y504H

DomainStartEndE-ValueType
coiled coil region 50 84 N/A INTRINSIC
low complexity region 87 97 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
ARM 577 617 1.85e-8 SMART
ARM 621 662 1.15e-9 SMART
ARM 663 720 1.51e1 SMART
ARM 722 769 2.74e1 SMART
ARM 830 871 4.88e0 SMART
ARM 902 942 2.76e-7 SMART
low complexity region 964 973 N/A INTRINSIC
ARM 995 1039 5.64e-4 SMART
low complexity region 1086 1099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226119
AA Change: Y504H

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (76/76)
MGI Phenotype Strain: 3056606
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesive junction associated protein of the armadillo/beta-catenin superfamily and is implicated in brain and eye development and cancer formation. The protein encoded by this gene promotes the disruption of E-cadherin based adherens junction to favor cell spreading upon stimulation by hepatocyte growth factor. This gene is overexpressed in prostate adenocarcinomas and is associated with decreased expression of tumor suppressor E-cadherin in this tissue. This gene resides in a region of the short arm of chromosome 5 that is deleted in Cri du Chat syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal conditioning, spatial learning and coordination behaviors and abnormal long term potentiation. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot13 A T 13: 24,818,171 I96K probably benign Het
Adam6a A G 12: 113,545,671 T555A probably benign Het
Alms1 C T 6: 85,621,369 P1059L probably benign Het
Apol7c T C 15: 77,525,643 T368A probably benign Het
Arfgef3 A T 10: 18,599,267 L1557Q probably damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Bmp3 T A 5: 98,872,763 D348E probably damaging Het
Bves A G 10: 45,354,817 S295G probably damaging Het
Carmil1 A G 13: 24,020,069 C1328R probably benign Het
Ccnk T A 12: 108,187,258 Y93N probably damaging Het
Ccr1 A T 9: 123,964,052 V147D probably damaging Het
Cd24a G A 10: 43,582,640 G36S probably benign Het
Cep104 A G 4: 153,992,867 Y569C probably damaging Het
Chd2 A T 7: 73,475,420 I884N probably damaging Het
Cnst A T 1: 179,579,382 probably benign Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Col25a1 G T 3: 130,530,119 R321L probably damaging Het
D3Ertd751e C A 3: 41,748,708 Q73K probably damaging Het
Dsc2 C T 18: 20,035,275 probably null Het
Eya1 A T 1: 14,302,852 S14R probably damaging Het
Fam131c A T 4: 141,383,017 probably null Het
Fam71a G A 1: 191,164,021 R142C probably damaging Het
Flvcr2 T C 12: 85,747,191 F114L possibly damaging Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Galnt5 A C 2: 57,998,609 M74L probably benign Het
Gas2l2 G A 11: 83,422,462 P675S probably benign Het
Gm9508 G T 10: 77,696,636 Q200K unknown Het
Greb1l G A 18: 10,544,576 S1390N probably benign Het
Hdac5 G T 11: 102,204,559 T430K possibly damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Khnyn C T 14: 55,894,354 P578S probably damaging Het
Lepr A T 4: 101,745,659 T215S probably benign Het
Lrfn5 G A 12: 61,843,982 V686I probably benign Het
Mapkap1 T A 2: 34,518,700 H233Q possibly damaging Het
Mcm3 A G 1: 20,814,857 I201T probably damaging Het
Metrnl G A 11: 121,715,908 R263Q probably damaging Het
Mettl22 A G 16: 8,478,060 E71G probably benign Het
Muc16 T C 9: 18,642,008 T4330A probably benign Het
Mug1 A G 6: 121,857,420 T387A probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Nbas A G 12: 13,405,397 D1204G possibly damaging Het
Ncor2 T C 5: 125,055,783 K478E unknown Het
Olfr173 T A 16: 58,796,887 I320F probably benign Het
Olfr294 A T 7: 86,616,366 L93Q possibly damaging Het
Olfr557 A G 7: 102,698,270 T11A probably benign Het
Osbpl7 G A 11: 97,050,836 V62I probably benign Het
Pak1ip1 A G 13: 41,009,542 N246S probably damaging Het
Prim1 A G 10: 128,015,976 Y39C probably damaging Het
Prl3b1 G T 13: 27,243,844 V46L probably benign Het
Prss54 A T 8: 95,565,571 S127T probably benign Het
Rasal3 G A 17: 32,392,417 T912M probably damaging Het
Rrp12 T A 19: 41,883,778 T420S probably benign Het
Rspo1 A G 4: 125,005,038 N51D probably damaging Het
Rufy4 A G 1: 74,132,876 R253G probably benign Het
Scaf1 G A 7: 45,007,743 R571C unknown Het
Scn2a A T 2: 65,701,979 H645L probably damaging Het
Sec24b A G 3: 129,988,946 S1132P probably damaging Het
Slc1a2 A G 2: 102,755,945 K298R probably damaging Het
Slc25a54 T A 3: 109,107,257 N230K probably benign Het
Slc27a4 T G 2: 29,815,652 Y617* probably null Het
Slc2a10 T C 2: 165,515,349 S310P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spag9 A T 11: 94,089,432 probably null Het
Spg11 A T 2: 122,101,789 probably null Het
Sycp2l A G 13: 41,129,782 T165A probably damaging Het
Syt14 A G 1: 192,933,263 C189R probably damaging Het
Taar9 A T 10: 24,108,984 L184Q probably damaging Het
Tkt C T 14: 30,559,858 P111L probably damaging Het
Trpc1 A T 9: 95,721,144 L445Q possibly damaging Het
Usp53 A G 3: 122,949,710 S526P probably benign Het
Vps54 T G 11: 21,298,791 W447G probably damaging Het
Xirp2 A T 2: 67,509,833 H806L probably benign Het
Zfp451 A T 1: 33,802,570 H410Q unknown Het
Zfp688 A G 7: 127,419,312 C214R probably damaging Het
Zic4 A G 9: 91,379,121 D143G possibly damaging Het
Other mutations in Ctnnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Ctnnd2 APN 15 30647141 missense possibly damaging 0.73
IGL01612:Ctnnd2 APN 15 31005018 missense probably damaging 1.00
IGL01923:Ctnnd2 APN 15 30480828 missense probably damaging 0.99
IGL02183:Ctnnd2 APN 15 31020740 missense probably damaging 1.00
IGL02186:Ctnnd2 APN 15 30480793 missense probably damaging 0.99
IGL02226:Ctnnd2 APN 15 30847336 missense probably benign 0.01
IGL02307:Ctnnd2 APN 15 30647211 missense possibly damaging 0.86
IGL02407:Ctnnd2 APN 15 30966768 missense probably damaging 1.00
IGL02474:Ctnnd2 APN 15 30669562 missense possibly damaging 0.71
IGL02718:Ctnnd2 APN 15 31027616 missense probably damaging 1.00
IGL03249:Ctnnd2 APN 15 30683236 missense probably benign 0.45
IGL03328:Ctnnd2 APN 15 30921847 splice site probably benign
carpe UTSW 15 30905820 missense probably damaging 1.00
diem UTSW 15 30683347 missense possibly damaging 0.85
P0016:Ctnnd2 UTSW 15 30966938 missense probably benign 0.00
R0130:Ctnnd2 UTSW 15 30921913 missense probably damaging 1.00
R0408:Ctnnd2 UTSW 15 30634677 missense probably damaging 1.00
R0611:Ctnnd2 UTSW 15 31009084 missense possibly damaging 0.75
R0894:Ctnnd2 UTSW 15 30332155 splice site probably benign
R1112:Ctnnd2 UTSW 15 30921880 missense probably damaging 1.00
R1459:Ctnnd2 UTSW 15 30847299 missense probably damaging 1.00
R1529:Ctnnd2 UTSW 15 30887121 missense possibly damaging 0.91
R1532:Ctnnd2 UTSW 15 30921868 missense probably damaging 1.00
R1701:Ctnnd2 UTSW 15 30921981 missense probably damaging 1.00
R1807:Ctnnd2 UTSW 15 30619871 missense probably damaging 1.00
R1881:Ctnnd2 UTSW 15 31005081 splice site probably benign
R1960:Ctnnd2 UTSW 15 30647111 missense probably damaging 0.96
R2121:Ctnnd2 UTSW 15 30669514 missense probably damaging 1.00
R3839:Ctnnd2 UTSW 15 31009028 splice site probably null
R3967:Ctnnd2 UTSW 15 30646929 missense possibly damaging 0.81
R3980:Ctnnd2 UTSW 15 30669443 missense probably benign 0.14
R4207:Ctnnd2 UTSW 15 30972827 missense probably damaging 0.99
R4279:Ctnnd2 UTSW 15 30905820 missense probably damaging 1.00
R4498:Ctnnd2 UTSW 15 30619874 missense probably damaging 1.00
R4622:Ctnnd2 UTSW 15 30887169 missense probably benign 0.17
R4622:Ctnnd2 UTSW 15 31009113 missense probably benign 0.00
R4860:Ctnnd2 UTSW 15 30881167 missense probably damaging 1.00
R4860:Ctnnd2 UTSW 15 30881167 missense probably damaging 1.00
R4979:Ctnnd2 UTSW 15 31009075 missense probably damaging 1.00
R5086:Ctnnd2 UTSW 15 30683347 missense possibly damaging 0.85
R5330:Ctnnd2 UTSW 15 30332115 missense probably damaging 1.00
R5459:Ctnnd2 UTSW 15 30887188 missense probably damaging 1.00
R5595:Ctnnd2 UTSW 15 30669543 missense probably benign 0.07
R5809:Ctnnd2 UTSW 15 30847377 missense probably damaging 1.00
R5987:Ctnnd2 UTSW 15 30683241 missense probably benign
R6245:Ctnnd2 UTSW 15 30905748 missense probably damaging 1.00
R6379:Ctnnd2 UTSW 15 30634698 missense probably damaging 1.00
R6737:Ctnnd2 UTSW 15 30966834 nonsense probably null
R6979:Ctnnd2 UTSW 15 30619230 missense probably damaging 0.99
R7133:Ctnnd2 UTSW 15 30480849 missense possibly damaging 0.47
R7267:Ctnnd2 UTSW 15 30683355 missense probably benign 0.13
R7275:Ctnnd2 UTSW 15 30905709 missense possibly damaging 0.94
R7386:Ctnnd2 UTSW 15 30966768 missense probably damaging 1.00
Z1088:Ctnnd2 UTSW 15 30966813 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACCGTTTCTGTGAGCAGGTC -3'
(R):5'- CAGGCAGTAACAGCTCACAG -3'

Sequencing Primer
(F):5'- GAGCAGGTCCTCAATTTTT -3'
(R):5'- TCACAGCGTGCCGAGAG -3'
Posted On2019-06-26