Mutagenetix > Incidental Mutation

Incidental Mutation 'R7179:Greb1l'

558876

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

045269-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7179 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 10544576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 1390 (S1390N)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: S1390N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: S1390N

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

100% (76/76)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot13	A	T	13: 24,818,171	I96K	probably benign	Het
Adam6a	A	G	12: 113,545,671	T555A	probably benign	Het
Alms1	C	T	6: 85,621,369	P1059L	probably benign	Het
Apol7c	T	C	15: 77,525,643	T368A	probably benign	Het
Arfgef3	A	T	10: 18,599,267	L1557Q	probably damaging	Het
Baz2a	C	T	10: 128,124,457	R1514W	probably damaging	Het
Bmp3	T	A	5: 98,872,763	D348E	probably damaging	Het
Bves	A	G	10: 45,354,817	S295G	probably damaging	Het
Carmil1	A	G	13: 24,020,069	C1328R	probably benign	Het
Ccnk	T	A	12: 108,187,258	Y93N	probably damaging	Het
Ccr1	A	T	9: 123,964,052	V147D	probably damaging	Het
Cd24a	G	A	10: 43,582,640	G36S	probably benign	Het
Cep104	A	G	4: 153,992,867	Y569C	probably damaging	Het
Chd2	A	T	7: 73,475,420	I884N	probably damaging	Het
Cnst	A	T	1: 179,579,382		probably benign	Het
Col22a1	A	G	15: 71,933,413	L146P	unknown	Het
Col25a1	G	T	3: 130,530,119	R321L	probably damaging	Het
Ctnnd2	T	C	15: 30,683,364	Y504H	possibly damaging	Het
D3Ertd751e	C	A	3: 41,748,708	Q73K	probably damaging	Het
Dsc2	C	T	18: 20,035,275		probably null	Het
Eya1	A	T	1: 14,302,852	S14R	probably damaging	Het
Fam131c	A	T	4: 141,383,017		probably null	Het
Fam71a	G	A	1: 191,164,021	R142C	probably damaging	Het
Flvcr2	T	C	12: 85,747,191	F114L	possibly damaging	Het
Fyn	A	G	10: 39,532,124	D321G	possibly damaging	Het
Galnt5	A	C	2: 57,998,609	M74L	probably benign	Het
Gas2l2	G	A	11: 83,422,462	P675S	probably benign	Het
Gm9508	G	T	10: 77,696,636	Q200K	unknown	Het
Hdac5	G	T	11: 102,204,559	T430K	possibly damaging	Het
Hjurp	TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT	TCT	1: 88,266,278		probably benign	Het
Khnyn	C	T	14: 55,894,354	P578S	probably damaging	Het
Lepr	A	T	4: 101,745,659	T215S	probably benign	Het
Lrfn5	G	A	12: 61,843,982	V686I	probably benign	Het
Mapkap1	T	A	2: 34,518,700	H233Q	possibly damaging	Het
Mcm3	A	G	1: 20,814,857	I201T	probably damaging	Het
Metrnl	G	A	11: 121,715,908	R263Q	probably damaging	Het
Mettl22	A	G	16: 8,478,060	E71G	probably benign	Het
Muc16	T	C	9: 18,642,008	T4330A	probably benign	Het
Mug1	A	G	6: 121,857,420	T387A	probably benign	Het
Myh4	A	G	11: 67,244,724	D379G	probably benign	Het
Nbas	A	G	12: 13,405,397	D1204G	possibly damaging	Het
Ncor2	T	C	5: 125,055,783	K478E	unknown	Het
Olfr173	T	A	16: 58,796,887	I320F	probably benign	Het
Olfr294	A	T	7: 86,616,366	L93Q	possibly damaging	Het
Olfr557	A	G	7: 102,698,270	T11A	probably benign	Het
Osbpl7	G	A	11: 97,050,836	V62I	probably benign	Het
Pak1ip1	A	G	13: 41,009,542	N246S	probably damaging	Het
Prim1	A	G	10: 128,015,976	Y39C	probably damaging	Het
Prl3b1	G	T	13: 27,243,844	V46L	probably benign	Het
Prss54	A	T	8: 95,565,571	S127T	probably benign	Het
Rasal3	G	A	17: 32,392,417	T912M	probably damaging	Het
Rrp12	T	A	19: 41,883,778	T420S	probably benign	Het
Rspo1	A	G	4: 125,005,038	N51D	probably damaging	Het
Rufy4	A	G	1: 74,132,876	R253G	probably benign	Het
Scaf1	G	A	7: 45,007,743	R571C	unknown	Het
Scn2a	A	T	2: 65,701,979	H645L	probably damaging	Het
Sec24b	A	G	3: 129,988,946	S1132P	probably damaging	Het
Slc1a2	A	G	2: 102,755,945	K298R	probably damaging	Het
Slc25a54	T	A	3: 109,107,257	N230K	probably benign	Het
Slc27a4	T	G	2: 29,815,652	Y617*	probably null	Het
Slc2a10	T	C	2: 165,515,349	S310P	probably damaging	Het
Snx33	C	T	9: 56,925,867	R306H	probably damaging	Het
Spag9	A	T	11: 94,089,432		probably null	Het
Spg11	A	T	2: 122,101,789		probably null	Het
Sycp2l	A	G	13: 41,129,782	T165A	probably damaging	Het
Syt14	A	G	1: 192,933,263	C189R	probably damaging	Het
Taar9	A	T	10: 24,108,984	L184Q	probably damaging	Het
Tkt	C	T	14: 30,559,858	P111L	probably damaging	Het
Trpc1	A	T	9: 95,721,144	L445Q	possibly damaging	Het
Usp53	A	G	3: 122,949,710	S526P	probably benign	Het
Vps54	T	G	11: 21,298,791	W447G	probably damaging	Het
Xirp2	A	T	2: 67,509,833	H806L	probably benign	Het
Zfp451	A	T	1: 33,802,570	H410Q	unknown	Het
Zfp688	A	G	7: 127,419,312	C214R	probably damaging	Het
Zic4	A	G	9: 91,379,121	D143G	possibly damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTTGATATACCTGTTCAGGATG -3'
(R):5'- TTTGAGCCCTAGCAAGCAAG -3'

Sequencing Primer
(F):5'- ATATACCTGTTCAGGATGGTGGTGAG -3'
(R):5'- GCAAGTTTAAAAGTCAAGATGTGCC -3'

Posted On

2019-06-26