Mutagenetix > Incidental Mutations

Incidental Mutation 'R7180:Eif5b'

558879

Institutional Source

Beutler Lab

Gene Symbol

Eif5b

Ensembl Gene

ENSMUSG00000026083

Gene Name

eukaryotic translation initiation factor 5B

Synonyms

A030003E17Rik, IF2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7180 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37998010-38055579 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38049074 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1020 (M1020L)

Ref Sequence

ENSEMBL: ENSMUSP00000027252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000027252]

Predicted Effect

probably benign
Transcript: ENSMUST00000027251

SMART Domains

Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082

Domain	Start	End	E-Value	Type
BRCT	46	121	3.99e-13	SMART
low complexity region	320	342	N/A	INTRINSIC
Pfam:IMS	420	620	1.9e-43	PFAM
Pfam:IMS_C	700	831	5.8e-20	PFAM
low complexity region	888	901	N/A	INTRINSIC
Pfam:DUF4414	938	1071	9.7e-11	PFAM
Pfam:REV1_C	1127	1248	1.2e-43	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000027252
AA Change: M1020L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: M1020L

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
low complexity region	33	51	N/A	INTRINSIC
low complexity region	94	106	N/A	INTRINSIC
low complexity region	110	126	N/A	INTRINSIC
low complexity region	145	161	N/A	INTRINSIC
low complexity region	183	193	N/A	INTRINSIC
coiled coil region	227	272	N/A	INTRINSIC
coiled coil region	301	414	N/A	INTRINSIC
low complexity region	480	498	N/A	INTRINSIC
coiled coil region	523	554	N/A	INTRINSIC
low complexity region	580	594	N/A	INTRINSIC
Pfam:GTP_EFTU	625	840	4.7e-35	PFAM
Pfam:MMR_HSR1	629	753	5.1e-6	PFAM
Pfam:GTP_EFTU_D2	866	944	7.1e-11	PFAM
Pfam:IF-2	959	1066	1.4e-20	PFAM
Blast:S1	1116	1172	2e-6	BLAST

Meta Mutation Damage Score

0.1899

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat2	A	C	4: 49,381,803	Y196*	probably null	Het
Agrn	C	T	4: 156,171,839	R1405H	probably benign	Het
Agtpbp1	G	A	13: 59,466,038	H1030Y	probably benign	Het
Ankrd37	C	T	8: 45,999,854		probably benign	Het
Ap1g2	G	C	14: 55,104,451	P218R	probably damaging	Het
Ap2a1	C	T	7: 44,923,804		probably null	Het
Apc2	T	A	10: 80,311,156	D681E	possibly damaging	Het
Arhgef5	T	A	6: 43,275,208	N964K	possibly damaging	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
Ccnf	T	A	17: 24,223,915	M773L	probably benign	Het
Ces1e	A	C	8: 93,215,144	S234A	probably damaging	Het
Ces1g	T	A	8: 93,302,948	E552V	probably benign	Het
Ctcfl	A	T	2: 173,105,977		probably null	Het
Dkk2	T	A	3: 132,086,192	S54T	probably damaging	Het
Dll1	A	G	17: 15,374,869	S49P	probably benign	Het
Dscam	C	A	16: 96,825,564	A382S	probably damaging	Het
Enpp4	T	C	17: 44,102,037	D202G	probably benign	Het
Eps8	A	T	6: 137,479,074	I803N	possibly damaging	Het
Etv2	C	A	7: 30,635,649	G28V	probably damaging	Het
Fadd	A	T	7: 144,580,785	V121E	probably damaging	Het
Fam149b	T	C	14: 20,381,785	Y545H	probably benign	Het
Fam196b	A	G	11: 34,419,873	K526E	probably damaging	Het
Fbxl21	A	T	13: 56,523,527	M1L	probably benign	Het
Flg2	T	C	3: 93,202,833	S723P	unknown	Het
Gm4884	C	T	7: 41,044,209	T534I	possibly damaging	Het
Gm8994	T	A	6: 136,329,537	I332N	probably damaging	Het
Gpbar1	A	T	1: 74,278,633	I12F	possibly damaging	Het
Gpr151	A	T	18: 42,578,956	L219*	probably null	Het
Hdgfl2	T	A	17: 56,097,532		probably null	Het
Hectd4	A	G	5: 121,308,342	M200V	probably benign	Het
Idua	A	G	5: 108,680,895	N335S	probably benign	Het
Ifit1bl1	A	T	19: 34,593,902	F385Y	probably damaging	Het
Ift172	T	C	5: 31,254,262	D1624G	probably damaging	Het
Igsf9b	A	T	9: 27,322,668	T388S	possibly damaging	Het
Ikbkap	A	T	4: 56,796,535	S118R	probably damaging	Het
Jak2	A	G	19: 29,282,411	I237V	probably benign	Het
Kat5	C	A	19: 5,603,961	K398N	probably damaging	Het
Lmbrd2	T	A	15: 9,175,196	V398E	possibly damaging	Het
Lrp1	T	C	10: 127,556,965	N2744D	probably damaging	Het
Lrrd1	T	C	5: 3,851,459	I588T	probably damaging	Het
Ltn1	A	G	16: 87,418,494	F418L	probably damaging	Het
Magi1	T	A	6: 93,815,750	D169V	probably benign	Het
Mpdz	T	C	4: 81,335,751	E1048G	probably damaging	Het
Myh9	T	C	15: 77,807,910	I150V	probably benign	Het
Nckap1	A	T	2: 80,506,892	M1006K	probably benign	Het
Nkain1	C	T	4: 130,533,925	V132I	probably benign	Het
Npy6r	A	T	18: 44,276,156	M215L	probably benign	Het
Nr3c2	A	T	8: 76,908,963	Q231L	probably damaging	Het
Obox5	C	T	7: 15,757,924	P88L	probably benign	Het
Olfr514	A	G	7: 108,825,979	S7P	probably damaging	Het
Olfr827	T	C	10: 130,210,942	T63A	probably benign	Het
P2rx7	A	G	5: 122,680,820	D435G	possibly damaging	Het
Pdzd2	T	A	15: 12,376,123	S1309C	probably damaging	Het
Pex5l	C	T	3: 33,024,691		probably null	Het
Pip	T	A	6: 41,847,631	C18S	probably damaging	Het
Pla2g7	C	T	17: 43,599,076	T157M	probably damaging	Het
Plce1	A	G	19: 38,779,785	Y2168C	probably damaging	Het
Rgs2	T	C	1: 144,002,148	T137A	probably benign	Het
Rpl32	T	A	6: 115,807,807	I31F	possibly damaging	Het
Ryr2	T	C	13: 11,686,978	Y2931C	probably damaging	Het
Slc4a4	G	A	5: 89,046,236	E192K	probably damaging	Het
Slc4a7	G	A	14: 14,765,580	A521T	probably damaging	Het
Smchd1	T	C	17: 71,394,823	E1058G	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Ssc5d	A	G	7: 4,936,601	T679A	probably benign	Het
Tas2r130	A	C	6: 131,630,248	S195A	probably benign	Het
Tas2r135	C	T	6: 42,405,751	R75*	probably null	Het
Terf2ip	G	T	8: 112,011,420		probably benign	Het
Tm6sf2	G	A	8: 70,076,006	R136K	probably benign	Het
Tmprss15	A	G	16: 78,967,998	L858P	probably damaging	Het
Topaz1	A	G	9: 122,797,705	D1466G	possibly damaging	Het
Trip4	A	T	9: 65,857,345	L446Q	probably damaging	Het
Trpv3	G	T	11: 73,277,992	V93L	probably benign	Het
Ubl4b	A	T	3: 107,554,646	H99Q	probably damaging	Het
Unc45a	A	T	7: 80,329,821		probably null	Het
Vmn1r47	G	T	6: 90,022,353	A156S	probably damaging	Het
Vmn2r33	T	A	7: 7,563,897	H72L	probably benign	Het
Zeb1	G	A	18: 5,767,867	V793M	possibly damaging	Het
Zfp628	C	A	7: 4,921,064	Q762K	probably benign	Het

Other mutations in Eif5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Eif5b	APN	1	38041719	missense	probably damaging	1.00
IGL01377:Eif5b	APN	1	38036098	missense	probably benign
IGL01395:Eif5b	APN	1	38037258	missense	probably damaging	0.96
IGL01572:Eif5b	APN	1	38022254	nonsense	probably null
IGL01615:Eif5b	APN	1	38045706	missense	probably damaging	1.00
IGL02141:Eif5b	APN	1	38032322	missense	probably benign	0.09
IGL02260:Eif5b	APN	1	38045456	missense	possibly damaging	0.81
IGL02308:Eif5b	APN	1	38041747	missense	probably damaging	1.00
IGL03180:Eif5b	APN	1	38036269	missense	probably damaging	1.00
IGL03327:Eif5b	APN	1	38041691	splice site	probably benign
R0018:Eif5b	UTSW	1	38018889	missense	unknown
R0036:Eif5b	UTSW	1	38019111	missense	probably benign	0.23
R0137:Eif5b	UTSW	1	38019243	missense	probably benign	0.23
R0349:Eif5b	UTSW	1	38032366	missense	probably benign	0.18
R0606:Eif5b	UTSW	1	38048893	missense	probably damaging	1.00
R1056:Eif5b	UTSW	1	38022167	missense	unknown
R1225:Eif5b	UTSW	1	38037628	missense	probably damaging	1.00
R2043:Eif5b	UTSW	1	38041819	missense	probably damaging	1.00
R2163:Eif5b	UTSW	1	38048794	missense	probably benign	0.32
R2225:Eif5b	UTSW	1	38019223	missense	unknown
R2432:Eif5b	UTSW	1	38019342	missense	unknown
R2922:Eif5b	UTSW	1	38018019	splice site	probably benign
R4357:Eif5b	UTSW	1	38050258	missense	probably damaging	1.00
R4631:Eif5b	UTSW	1	38041747	missense	probably damaging	1.00
R4665:Eif5b	UTSW	1	38045712	missense	probably damaging	1.00
R4702:Eif5b	UTSW	1	38018877	missense	unknown
R4941:Eif5b	UTSW	1	38051199	missense	probably damaging	1.00
R4995:Eif5b	UTSW	1	38051711	makesense	probably null
R5020:Eif5b	UTSW	1	38019069	nonsense	probably null
R5175:Eif5b	UTSW	1	38045387	missense	probably damaging	1.00
R5375:Eif5b	UTSW	1	38045754	missense	possibly damaging	0.66
R5566:Eif5b	UTSW	1	38045684	missense	possibly damaging	0.90
R5566:Eif5b	UTSW	1	38051247	missense	probably damaging	1.00
R5853:Eif5b	UTSW	1	38037307	missense	probably damaging	1.00
R5978:Eif5b	UTSW	1	37998280	splice site	probably null
R6315:Eif5b	UTSW	1	38018033	missense	unknown
R6376:Eif5b	UTSW	1	38045679	missense	probably damaging	0.98
R6388:Eif5b	UTSW	1	38019000	missense	unknown
R6444:Eif5b	UTSW	1	38036211	missense	probably damaging	1.00
R6455:Eif5b	UTSW	1	38019027	missense	probably benign	0.23
R6810:Eif5b	UTSW	1	38046660	missense	probably benign	0.45
R6877:Eif5b	UTSW	1	38050239	missense	probably damaging	1.00
R7130:Eif5b	UTSW	1	38041776	missense	probably damaging	1.00
R7439:Eif5b	UTSW	1	38051637	missense	probably benign	0.28
R7488:Eif5b	UTSW	1	38050306	missense	possibly damaging	0.69
R8140:Eif5b	UTSW	1	38051276	missense	probably benign	0.41
R8166:Eif5b	UTSW	1	38048820	missense	probably benign	0.11
R8191:Eif5b	UTSW	1	38036202	missense	probably damaging	0.98
R8304:Eif5b	UTSW	1	38045693	missense	probably benign	0.11
R8549:Eif5b	UTSW	1	38037207	missense	possibly damaging	0.96
RF018:Eif5b	UTSW	1	38021592	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCATCTACACTGGGCTCTTTG -3'
(R):5'- TCTGCACTAAAGATTCTAACTCCC -3'

Sequencing Primer
(F):5'- ATCTACACTGGGCTCTTTGGAAGC -3'
(R):5'- CAAACTATCAGCCATCTCTTGTGCG -3'

Posted On

2019-06-26