Incidental Mutation 'R7180:Dkk2'
ID558888
Institutional Source Beutler Lab
Gene Symbol Dkk2
Ensembl Gene ENSMUSG00000028031
Gene Namedickkopf WNT signaling pathway inhibitor 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R7180 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location132085292-132180304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132086192 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 54 (S54T)
Ref Sequence ENSEMBL: ENSMUSP00000029665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029665]
PDB Structure
A functional domain of a Wnt signal protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000029665
AA Change: S54T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029665
Gene: ENSMUSG00000028031
AA Change: S54T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Dickkopf_N 77 128 6.4e-20 PFAM
PDB:2JTK|A 172 259 5e-60 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6). [provided by RefSeq, Jul 2008]
PHENOTYPE: mice homozygous for a targeted disruption are osteopenic with defective mineralization of induced osteoblasts in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A C 4: 49,381,803 Y196* probably null Het
Agrn C T 4: 156,171,839 R1405H probably benign Het
Agtpbp1 G A 13: 59,466,038 H1030Y probably benign Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Ap1g2 G C 14: 55,104,451 P218R probably damaging Het
Ap2a1 C T 7: 44,923,804 probably null Het
Apc2 T A 10: 80,311,156 D681E possibly damaging Het
Arhgef5 T A 6: 43,275,208 N964K possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Ccnf T A 17: 24,223,915 M773L probably benign Het
Ces1e A C 8: 93,215,144 S234A probably damaging Het
Ces1g T A 8: 93,302,948 E552V probably benign Het
Ctcfl A T 2: 173,105,977 probably null Het
Dll1 A G 17: 15,374,869 S49P probably benign Het
Dscam C A 16: 96,825,564 A382S probably damaging Het
Eif5b A T 1: 38,049,074 M1020L probably damaging Het
Enpp4 T C 17: 44,102,037 D202G probably benign Het
Eps8 A T 6: 137,479,074 I803N possibly damaging Het
Etv2 C A 7: 30,635,649 G28V probably damaging Het
Fadd A T 7: 144,580,785 V121E probably damaging Het
Fam149b T C 14: 20,381,785 Y545H probably benign Het
Fam196b A G 11: 34,419,873 K526E probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Flg2 T C 3: 93,202,833 S723P unknown Het
Gm4884 C T 7: 41,044,209 T534I possibly damaging Het
Gm8994 T A 6: 136,329,537 I332N probably damaging Het
Gpbar1 A T 1: 74,278,633 I12F possibly damaging Het
Gpr151 A T 18: 42,578,956 L219* probably null Het
Hdgfl2 T A 17: 56,097,532 probably null Het
Hectd4 A G 5: 121,308,342 M200V probably benign Het
Idua A G 5: 108,680,895 N335S probably benign Het
Ifit1bl1 A T 19: 34,593,902 F385Y probably damaging Het
Ift172 T C 5: 31,254,262 D1624G probably damaging Het
Igsf9b A T 9: 27,322,668 T388S possibly damaging Het
Ikbkap A T 4: 56,796,535 S118R probably damaging Het
Jak2 A G 19: 29,282,411 I237V probably benign Het
Kat5 C A 19: 5,603,961 K398N probably damaging Het
Lmbrd2 T A 15: 9,175,196 V398E possibly damaging Het
Lrp1 T C 10: 127,556,965 N2744D probably damaging Het
Lrrd1 T C 5: 3,851,459 I588T probably damaging Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Magi1 T A 6: 93,815,750 D169V probably benign Het
Mpdz T C 4: 81,335,751 E1048G probably damaging Het
Myh9 T C 15: 77,807,910 I150V probably benign Het
Nckap1 A T 2: 80,506,892 M1006K probably benign Het
Nkain1 C T 4: 130,533,925 V132I probably benign Het
Npy6r A T 18: 44,276,156 M215L probably benign Het
Nr3c2 A T 8: 76,908,963 Q231L probably damaging Het
Obox5 C T 7: 15,757,924 P88L probably benign Het
Olfr514 A G 7: 108,825,979 S7P probably damaging Het
Olfr827 T C 10: 130,210,942 T63A probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Pdzd2 T A 15: 12,376,123 S1309C probably damaging Het
Pex5l C T 3: 33,024,691 probably null Het
Pip T A 6: 41,847,631 C18S probably damaging Het
Pla2g7 C T 17: 43,599,076 T157M probably damaging Het
Plce1 A G 19: 38,779,785 Y2168C probably damaging Het
Rgs2 T C 1: 144,002,148 T137A probably benign Het
Rpl32 T A 6: 115,807,807 I31F possibly damaging Het
Ryr2 T C 13: 11,686,978 Y2931C probably damaging Het
Slc4a4 G A 5: 89,046,236 E192K probably damaging Het
Slc4a7 G A 14: 14,765,580 A521T probably damaging Het
Smchd1 T C 17: 71,394,823 E1058G probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Ssc5d A G 7: 4,936,601 T679A probably benign Het
Tas2r130 A C 6: 131,630,248 S195A probably benign Het
Tas2r135 C T 6: 42,405,751 R75* probably null Het
Terf2ip G T 8: 112,011,420 probably benign Het
Tm6sf2 G A 8: 70,076,006 R136K probably benign Het
Tmprss15 A G 16: 78,967,998 L858P probably damaging Het
Topaz1 A G 9: 122,797,705 D1466G possibly damaging Het
Trip4 A T 9: 65,857,345 L446Q probably damaging Het
Trpv3 G T 11: 73,277,992 V93L probably benign Het
Ubl4b A T 3: 107,554,646 H99Q probably damaging Het
Unc45a A T 7: 80,329,821 probably null Het
Vmn1r47 G T 6: 90,022,353 A156S probably damaging Het
Vmn2r33 T A 7: 7,563,897 H72L probably benign Het
Zeb1 G A 18: 5,767,867 V793M possibly damaging Het
Zfp628 C A 7: 4,921,064 Q762K probably benign Het
Other mutations in Dkk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Dkk2 APN 3 132173803 missense probably damaging 1.00
IGL02351:Dkk2 APN 3 132177912 missense probably benign 0.03
IGL02358:Dkk2 APN 3 132177912 missense probably benign 0.03
IGL02942:Dkk2 APN 3 132178037 missense probably damaging 1.00
IGL03128:Dkk2 APN 3 132177860 splice site probably benign
IGL03367:Dkk2 APN 3 132178077 missense probably damaging 1.00
R2096:Dkk2 UTSW 3 132086097 missense probably benign 0.34
R3087:Dkk2 UTSW 3 132086139 missense probably damaging 1.00
R4815:Dkk2 UTSW 3 132173785 missense probably benign 0.00
R6777:Dkk2 UTSW 3 132173811 missense probably damaging 1.00
R6855:Dkk2 UTSW 3 132177922 missense probably damaging 1.00
R6901:Dkk2 UTSW 3 132175126 critical splice donor site probably null
R7013:Dkk2 UTSW 3 132174999 missense probably damaging 1.00
R7459:Dkk2 UTSW 3 132175029 missense probably benign 0.09
R7662:Dkk2 UTSW 3 132177868 critical splice acceptor site probably null
R7736:Dkk2 UTSW 3 132178014 missense probably damaging 1.00
RF008:Dkk2 UTSW 3 132178102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATTCCCATCTTTTCAGGG -3'
(R):5'- GAACTCTAAACCTCCCGCTG -3'

Sequencing Primer
(F):5'- ATCTTTTCAGGGCTCCACC -3'
(R):5'- AAGTCCTGGTACCCCTGCAG -3'
Posted On2019-06-26