Mutagenetix > Incidental Mutations

Incidental Mutation 'R7180:Mpdz'

558891

Institutional Source

Beutler Lab

Gene Symbol

Mpdz

Ensembl Gene

ENSMUSG00000028402

Gene Name

multiple PDZ domain protein

Synonyms

B930003D11Rik, MUPP1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7180 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81278500-81442815 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81335751 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1048 (E1048G)

Ref Sequence

ENSEMBL: ENSMUSP00000102879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000134572] [ENSMUST00000220807]

AlphaFold

Q8VBX6

Predicted Effect

probably damaging
Transcript: ENSMUST00000102830
AA Change: E1048G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402
AA Change: E1048G

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1111	1126	N/A	INTRINSIC
PDZ	1148	1231	2.43e-22	SMART
low complexity region	1233	1251	N/A	INTRINSIC
PDZ	1346	1421	3.41e-17	SMART
low complexity region	1434	1445	N/A	INTRINSIC
low complexity region	1454	1468	N/A	INTRINSIC
PDZ	1479	1552	2.69e-15	SMART
PDZ	1622	1697	3.2e-22	SMART
PDZ	1719	1792	3.62e-21	SMART
low complexity region	1798	1815	N/A	INTRINSIC
PDZ	1856	1933	9.79e-18	SMART
PDZ	1980	2055	2.39e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107258
AA Change: E1048G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402
AA Change: E1048G

Domain	Start	End	E-Value	Type
PDZ	1	73	3.42e-8	SMART
low complexity region	104	119	N/A	INTRINSIC
PDZ	141	224	2.43e-22	SMART
PDZ	306	381	3.41e-17	SMART
low complexity region	394	405	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
PDZ	439	512	2.69e-15	SMART
PDZ	582	657	3.2e-22	SMART
PDZ	679	752	3.62e-21	SMART
low complexity region	758	775	N/A	INTRINSIC
PDZ	816	893	9.79e-18	SMART
PDZ	940	1015	2.39e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107262
AA Change: E1048G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402
AA Change: E1048G

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1112	1127	N/A	INTRINSIC
PDZ	1149	1232	2.43e-22	SMART
low complexity region	1234	1252	N/A	INTRINSIC
PDZ	1347	1422	3.41e-17	SMART
low complexity region	1435	1446	N/A	INTRINSIC
low complexity region	1455	1469	N/A	INTRINSIC
PDZ	1480	1553	2.69e-15	SMART
PDZ	1623	1698	3.2e-22	SMART
PDZ	1720	1793	3.62e-21	SMART
low complexity region	1799	1816	N/A	INTRINSIC
PDZ	1857	1934	9.79e-18	SMART
PDZ	1981	2056	2.39e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000134572
AA Change: E27G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122308
Gene: ENSMUSG00000028402
AA Change: E27G

Domain	Start	End	E-Value	Type
PDZ	1	59	1.9e-1	SMART
PDB:2FCF\|A	87	138	1e-30	PDB
Blast:PDZ	96	138	7e-22	BLAST
SCOP:d1be9a_	104	138	2e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000220807
AA Change: E1048G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat2	A	C	4: 49,381,803	Y196*	probably null	Het
Agrn	C	T	4: 156,171,839	R1405H	probably benign	Het
Agtpbp1	G	A	13: 59,466,038	H1030Y	probably benign	Het
Ankrd37	C	T	8: 45,999,854		probably benign	Het
Ap1g2	G	C	14: 55,104,451	P218R	probably damaging	Het
Ap2a1	C	T	7: 44,923,804		probably null	Het
Apc2	T	A	10: 80,311,156	D681E	possibly damaging	Het
Arhgef5	T	A	6: 43,275,208	N964K	possibly damaging	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
Ccnf	T	A	17: 24,223,915	M773L	probably benign	Het
Ces1e	A	C	8: 93,215,144	S234A	probably damaging	Het
Ces1g	T	A	8: 93,302,948	E552V	probably benign	Het
Ctcfl	A	T	2: 173,105,977		probably null	Het
Dkk2	T	A	3: 132,086,192	S54T	probably damaging	Het
Dll1	A	G	17: 15,374,869	S49P	probably benign	Het
Dscam	C	A	16: 96,825,564	A382S	probably damaging	Het
Eif5b	A	T	1: 38,049,074	M1020L	probably damaging	Het
Enpp4	T	C	17: 44,102,037	D202G	probably benign	Het
Eps8	A	T	6: 137,479,074	I803N	possibly damaging	Het
Etv2	C	A	7: 30,635,649	G28V	probably damaging	Het
Fadd	A	T	7: 144,580,785	V121E	probably damaging	Het
Fam149b	T	C	14: 20,381,785	Y545H	probably benign	Het
Fam196b	A	G	11: 34,419,873	K526E	probably damaging	Het
Fbxl21	A	T	13: 56,523,527	M1L	probably benign	Het
Flg2	T	C	3: 93,202,833	S723P	unknown	Het
Gm4884	C	T	7: 41,044,209	T534I	possibly damaging	Het
Gm8994	T	A	6: 136,329,537	I332N	probably damaging	Het
Gpbar1	A	T	1: 74,278,633	I12F	possibly damaging	Het
Gpr151	A	T	18: 42,578,956	L219*	probably null	Het
Hdgfl2	T	A	17: 56,097,532		probably null	Het
Hectd4	A	G	5: 121,308,342	M200V	probably benign	Het
Idua	A	G	5: 108,680,895	N335S	probably benign	Het
Ifit1bl1	A	T	19: 34,593,902	F385Y	probably damaging	Het
Ift172	T	C	5: 31,254,262	D1624G	probably damaging	Het
Igsf9b	A	T	9: 27,322,668	T388S	possibly damaging	Het
Ikbkap	A	T	4: 56,796,535	S118R	probably damaging	Het
Jak2	A	G	19: 29,282,411	I237V	probably benign	Het
Kat5	C	A	19: 5,603,961	K398N	probably damaging	Het
Lmbrd2	T	A	15: 9,175,196	V398E	possibly damaging	Het
Lrp1	T	C	10: 127,556,965	N2744D	probably damaging	Het
Lrrd1	T	C	5: 3,851,459	I588T	probably damaging	Het
Ltn1	A	G	16: 87,418,494	F418L	probably damaging	Het
Magi1	T	A	6: 93,815,750	D169V	probably benign	Het
Myh9	T	C	15: 77,807,910	I150V	probably benign	Het
Nckap1	A	T	2: 80,506,892	M1006K	probably benign	Het
Nkain1	C	T	4: 130,533,925	V132I	probably benign	Het
Npy6r	A	T	18: 44,276,156	M215L	probably benign	Het
Nr3c2	A	T	8: 76,908,963	Q231L	probably damaging	Het
Obox5	C	T	7: 15,757,924	P88L	probably benign	Het
Olfr514	A	G	7: 108,825,979	S7P	probably damaging	Het
Olfr827	T	C	10: 130,210,942	T63A	probably benign	Het
P2rx7	A	G	5: 122,680,820	D435G	possibly damaging	Het
Pdzd2	T	A	15: 12,376,123	S1309C	probably damaging	Het
Pex5l	C	T	3: 33,024,691		probably null	Het
Pip	T	A	6: 41,847,631	C18S	probably damaging	Het
Pla2g7	C	T	17: 43,599,076	T157M	probably damaging	Het
Plce1	A	G	19: 38,779,785	Y2168C	probably damaging	Het
Rgs2	T	C	1: 144,002,148	T137A	probably benign	Het
Rpl32	T	A	6: 115,807,807	I31F	possibly damaging	Het
Ryr2	T	C	13: 11,686,978	Y2931C	probably damaging	Het
Slc4a4	G	A	5: 89,046,236	E192K	probably damaging	Het
Slc4a7	G	A	14: 14,765,580	A521T	probably damaging	Het
Smchd1	T	C	17: 71,394,823	E1058G	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Ssc5d	A	G	7: 4,936,601	T679A	probably benign	Het
Tas2r130	A	C	6: 131,630,248	S195A	probably benign	Het
Tas2r135	C	T	6: 42,405,751	R75*	probably null	Het
Terf2ip	G	T	8: 112,011,420		probably benign	Het
Tm6sf2	G	A	8: 70,076,006	R136K	probably benign	Het
Tmprss15	A	G	16: 78,967,998	L858P	probably damaging	Het
Topaz1	A	G	9: 122,797,705	D1466G	possibly damaging	Het
Trip4	A	T	9: 65,857,345	L446Q	probably damaging	Het
Trpv3	G	T	11: 73,277,992	V93L	probably benign	Het
Ubl4b	A	T	3: 107,554,646	H99Q	probably damaging	Het
Unc45a	A	T	7: 80,329,821		probably null	Het
Vmn1r47	G	T	6: 90,022,353	A156S	probably damaging	Het
Vmn2r33	T	A	7: 7,563,897	H72L	probably benign	Het
Zeb1	G	A	18: 5,767,867	V793M	possibly damaging	Het
Zfp628	C	A	7: 4,921,064	Q762K	probably benign	Het

Other mutations in Mpdz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Mpdz	APN	4	81310224	nonsense	probably null
IGL00325:Mpdz	APN	4	81317631	missense	probably damaging	1.00
IGL00497:Mpdz	APN	4	81335742	missense	probably benign	0.30
IGL00502:Mpdz	APN	4	81369723	missense	probably damaging	1.00
IGL00539:Mpdz	APN	4	81361351	missense	possibly damaging	0.83
IGL00938:Mpdz	APN	4	81292512	missense	probably damaging	1.00
IGL00990:Mpdz	APN	4	81303584	splice site	probably benign
IGL01394:Mpdz	APN	4	81292491	missense	possibly damaging	0.92
IGL01537:Mpdz	APN	4	81369658	missense	probably damaging	0.98
IGL01558:Mpdz	APN	4	81295530	nonsense	probably null
IGL01561:Mpdz	APN	4	81284614	missense	probably damaging	1.00
IGL01649:Mpdz	APN	4	81303633	missense	probably damaging	0.98
IGL01743:Mpdz	APN	4	81317682	missense	probably damaging	1.00
IGL01941:Mpdz	APN	4	81286387	missense	possibly damaging	0.91
IGL01969:Mpdz	APN	4	81358724	missense	probably damaging	0.98
IGL02023:Mpdz	APN	4	81329529	missense	probably damaging	0.99
IGL02081:Mpdz	APN	4	81335869	missense	probably damaging	1.00
IGL02304:Mpdz	APN	4	81310157	missense	possibly damaging	0.78
IGL02304:Mpdz	APN	4	81297559	splice site	probably benign
IGL02410:Mpdz	APN	4	81297493	missense	probably benign	0.13
IGL02449:Mpdz	APN	4	81329422	splice site	probably null
IGL02671:Mpdz	APN	4	81290273	missense	probably damaging	1.00
IGL02708:Mpdz	APN	4	81284571	splice site	probably null
IGL02718:Mpdz	APN	4	81385202	missense	probably damaging	1.00
IGL03065:Mpdz	APN	4	81292565	missense	probably damaging	0.98
IGL03378:Mpdz	APN	4	81419048	splice site	probably benign
PIT4458001:Mpdz	UTSW	4	81419026	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0119:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0402:Mpdz	UTSW	4	81361440	missense	possibly damaging	0.51
R0499:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0718:Mpdz	UTSW	4	81292473	missense	possibly damaging	0.79
R0844:Mpdz	UTSW	4	81421194	start gained	probably benign
R0883:Mpdz	UTSW	4	81359991	splice site	probably benign
R0885:Mpdz	UTSW	4	81369592	missense	probably benign	0.04
R1344:Mpdz	UTSW	4	81308319	missense	probably benign	0.01
R1432:Mpdz	UTSW	4	81292551	missense	probably damaging	1.00
R1488:Mpdz	UTSW	4	81348708	nonsense	probably null
R1589:Mpdz	UTSW	4	81421176	missense	probably benign	0.00
R1756:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R1940:Mpdz	UTSW	4	81361443	missense	probably benign	0.01
R2068:Mpdz	UTSW	4	81335830	missense	probably null	1.00
R2182:Mpdz	UTSW	4	81348722	missense	probably damaging	1.00
R2213:Mpdz	UTSW	4	81310172	missense	probably damaging	0.99
R2265:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2268:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2269:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R3082:Mpdz	UTSW	4	81285458	splice site	probably benign
R3746:Mpdz	UTSW	4	81363147	missense	probably damaging	1.00
R3902:Mpdz	UTSW	4	81307116	missense	probably damaging	1.00
R4095:Mpdz	UTSW	4	81383823	missense	possibly damaging	0.77
R4097:Mpdz	UTSW	4	81335700	missense	probably damaging	1.00
R4206:Mpdz	UTSW	4	81381762	missense	probably benign	0.13
R4675:Mpdz	UTSW	4	81383812	missense	probably damaging	0.98
R4884:Mpdz	UTSW	4	81361476	missense	probably damaging	0.97
R5044:Mpdz	UTSW	4	81381697	missense	probably benign	0.16
R5050:Mpdz	UTSW	4	81295448	missense	probably benign	0.00
R5243:Mpdz	UTSW	4	81306879	missense	probably damaging	1.00
R5332:Mpdz	UTSW	4	81292580	missense	probably damaging	1.00
R5435:Mpdz	UTSW	4	81283487	intron	probably benign
R5720:Mpdz	UTSW	4	81287694	missense	probably damaging	0.99
R5743:Mpdz	UTSW	4	81421188	start codon destroyed	probably null	0.30
R5764:Mpdz	UTSW	4	81356446	missense	probably benign	0.13
R5876:Mpdz	UTSW	4	81285474	nonsense	probably null
R5938:Mpdz	UTSW	4	81284614	missense	probably damaging	1.00
R5988:Mpdz	UTSW	4	81284575	critical splice donor site	probably null
R6125:Mpdz	UTSW	4	81297527	missense	probably benign	0.00
R6178:Mpdz	UTSW	4	81308365	missense	probably damaging	1.00
R6235:Mpdz	UTSW	4	81385281	missense	probably damaging	1.00
R6293:Mpdz	UTSW	4	81360056	missense	probably damaging	1.00
R6387:Mpdz	UTSW	4	81381709	missense	possibly damaging	0.69
R6488:Mpdz	UTSW	4	81287733	missense	probably benign	0.11
R6536:Mpdz	UTSW	4	81383417	missense	probably damaging	1.00
R6673:Mpdz	UTSW	4	81356430	missense	probably benign	0.11
R6879:Mpdz	UTSW	4	81348656	missense	possibly damaging	0.81
R7199:Mpdz	UTSW	4	81297333	missense	probably damaging	0.98
R7209:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R7309:Mpdz	UTSW	4	81381958	splice site	probably null
R7359:Mpdz	UTSW	4	81356395	missense	probably benign	0.01
R7561:Mpdz	UTSW	4	81307151	missense	probably damaging	0.99
R7565:Mpdz	UTSW	4	81303654	missense	probably benign	0.01
R7738:Mpdz	UTSW	4	81335749	missense	probably benign	0.01
R7941:Mpdz	UTSW	4	81282750	missense	probably benign	0.04
R8074:Mpdz	UTSW	4	81349087	missense	probably benign	0.00
R8957:Mpdz	UTSW	4	81332979	nonsense	probably null
R8998:Mpdz	UTSW	4	81284645	nonsense	probably null
R8999:Mpdz	UTSW	4	81284645	nonsense	probably null
R9001:Mpdz	UTSW	4	81381762	missense	probably benign
R9223:Mpdz	UTSW	4	81284630	missense	probably damaging	1.00
R9415:Mpdz	UTSW	4	81317668	nonsense	probably null
RF013:Mpdz	UTSW	4	81293592	missense	possibly damaging	0.60
X0011:Mpdz	UTSW	4	81292759	critical splice donor site	probably null
Z1177:Mpdz	UTSW	4	81320490	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGTTCTTAGCAAAGCACCAGATC -3'
(R):5'- GACAACGCTATCTGTGGTCC -3'

Sequencing Primer
(F):5'- TTTATCCGGGATCAAGAAACCAG -3'
(R):5'- GACAACGCTATCTGTGGTCCTTTTC -3'

Posted On

2019-06-26