Incidental Mutation 'R7180:Slc4a4'
ID558896
Institutional Source Beutler Lab
Gene Symbol Slc4a4
Ensembl Gene ENSMUSG00000060961
Gene Namesolute carrier family 4 (anion exchanger), member 4
SynonymsNBC1, NBC
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7180 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location88886818-89239653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89046236 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 192 (E192K)
Ref Sequence ENSEMBL: ENSMUSP00000108844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113216] [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000134303] [ENSMUST00000148750] [ENSMUST00000156238]
Predicted Effect probably benign
Transcript: ENSMUST00000113216
SMART Domains Protein: ENSMUSP00000108842
Gene: ENSMUSG00000060961

DomainStartEndE-ValueType
Pfam:Band_3_cyto 93 149 4.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113218
AA Change: E192K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: E192K

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 379 1.1e-100 PFAM
low complexity region 408 423 N/A INTRINSIC
Pfam:HCO3_cotransp 426 947 3e-246 PFAM
transmembrane domain 953 975 N/A INTRINSIC
low complexity region 999 1015 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130041
AA Change: E148K

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: E148K

DomainStartEndE-ValueType
Pfam:Band_3_cyto 93 344 1.5e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
Pfam:HCO3_cotransp 391 912 2.7e-246 PFAM
transmembrane domain 918 940 N/A INTRINSIC
low complexity region 964 980 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134303
AA Change: E148K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119976
Gene: ENSMUSG00000060961
AA Change: E148K

DomainStartEndE-ValueType
Pfam:Band_3_cyto 93 233 1.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148750
AA Change: E192K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: E192K

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 3.7e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 435 956 7.3e-246 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156238
AA Change: E192K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: E192K

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 4.6e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 436 956 4.1e-231 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A C 4: 49,381,803 Y196* probably null Het
Agrn C T 4: 156,171,839 R1405H probably benign Het
Agtpbp1 G A 13: 59,466,038 H1030Y probably benign Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Ap1g2 G C 14: 55,104,451 P218R probably damaging Het
Ap2a1 C T 7: 44,923,804 probably null Het
Apc2 T A 10: 80,311,156 D681E possibly damaging Het
Arhgef5 T A 6: 43,275,208 N964K possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Ccnf T A 17: 24,223,915 M773L probably benign Het
Ces1e A C 8: 93,215,144 S234A probably damaging Het
Ces1g T A 8: 93,302,948 E552V probably benign Het
Ctcfl A T 2: 173,105,977 probably null Het
Dkk2 T A 3: 132,086,192 S54T probably damaging Het
Dll1 A G 17: 15,374,869 S49P probably benign Het
Dscam C A 16: 96,825,564 A382S probably damaging Het
Eif5b A T 1: 38,049,074 M1020L probably damaging Het
Enpp4 T C 17: 44,102,037 D202G probably benign Het
Eps8 A T 6: 137,479,074 I803N possibly damaging Het
Etv2 C A 7: 30,635,649 G28V probably damaging Het
Fadd A T 7: 144,580,785 V121E probably damaging Het
Fam149b T C 14: 20,381,785 Y545H probably benign Het
Fam196b A G 11: 34,419,873 K526E probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Flg2 T C 3: 93,202,833 S723P unknown Het
Gm4884 C T 7: 41,044,209 T534I possibly damaging Het
Gm8994 T A 6: 136,329,537 I332N probably damaging Het
Gpbar1 A T 1: 74,278,633 I12F possibly damaging Het
Gpr151 A T 18: 42,578,956 L219* probably null Het
Hdgfl2 T A 17: 56,097,532 probably null Het
Hectd4 A G 5: 121,308,342 M200V probably benign Het
Idua A G 5: 108,680,895 N335S probably benign Het
Ifit1bl1 A T 19: 34,593,902 F385Y probably damaging Het
Ift172 T C 5: 31,254,262 D1624G probably damaging Het
Igsf9b A T 9: 27,322,668 T388S possibly damaging Het
Ikbkap A T 4: 56,796,535 S118R probably damaging Het
Jak2 A G 19: 29,282,411 I237V probably benign Het
Kat5 C A 19: 5,603,961 K398N probably damaging Het
Lmbrd2 T A 15: 9,175,196 V398E possibly damaging Het
Lrp1 T C 10: 127,556,965 N2744D probably damaging Het
Lrrd1 T C 5: 3,851,459 I588T probably damaging Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Magi1 T A 6: 93,815,750 D169V probably benign Het
Mpdz T C 4: 81,335,751 E1048G probably damaging Het
Myh9 T C 15: 77,807,910 I150V probably benign Het
Nckap1 A T 2: 80,506,892 M1006K probably benign Het
Nkain1 C T 4: 130,533,925 V132I probably benign Het
Npy6r A T 18: 44,276,156 M215L probably benign Het
Nr3c2 A T 8: 76,908,963 Q231L probably damaging Het
Obox5 C T 7: 15,757,924 P88L probably benign Het
Olfr514 A G 7: 108,825,979 S7P probably damaging Het
Olfr827 T C 10: 130,210,942 T63A probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Pdzd2 T A 15: 12,376,123 S1309C probably damaging Het
Pex5l C T 3: 33,024,691 probably null Het
Pip T A 6: 41,847,631 C18S probably damaging Het
Pla2g7 C T 17: 43,599,076 T157M probably damaging Het
Plce1 A G 19: 38,779,785 Y2168C probably damaging Het
Rgs2 T C 1: 144,002,148 T137A probably benign Het
Rpl32 T A 6: 115,807,807 I31F possibly damaging Het
Ryr2 T C 13: 11,686,978 Y2931C probably damaging Het
Slc4a7 G A 14: 14,765,580 A521T probably damaging Het
Smchd1 T C 17: 71,394,823 E1058G probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Ssc5d A G 7: 4,936,601 T679A probably benign Het
Tas2r130 A C 6: 131,630,248 S195A probably benign Het
Tas2r135 C T 6: 42,405,751 R75* probably null Het
Terf2ip G T 8: 112,011,420 probably benign Het
Tm6sf2 G A 8: 70,076,006 R136K probably benign Het
Tmprss15 A G 16: 78,967,998 L858P probably damaging Het
Topaz1 A G 9: 122,797,705 D1466G possibly damaging Het
Trip4 A T 9: 65,857,345 L446Q probably damaging Het
Trpv3 G T 11: 73,277,992 V93L probably benign Het
Ubl4b A T 3: 107,554,646 H99Q probably damaging Het
Unc45a A T 7: 80,329,821 probably null Het
Vmn1r47 G T 6: 90,022,353 A156S probably damaging Het
Vmn2r33 T A 7: 7,563,897 H72L probably benign Het
Zeb1 G A 18: 5,767,867 V793M possibly damaging Het
Zfp628 C A 7: 4,921,064 Q762K probably benign Het
Other mutations in Slc4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Slc4a4 APN 5 89179686 missense probably benign 0.01
IGL00976:Slc4a4 APN 5 88954798 missense probably damaging 1.00
IGL01074:Slc4a4 APN 5 89179774 missense probably damaging 1.00
IGL01120:Slc4a4 APN 5 89132379 missense probably damaging 1.00
IGL01284:Slc4a4 APN 5 89129673 missense probably benign 0.22
IGL01375:Slc4a4 APN 5 89179734 missense probably damaging 1.00
IGL01399:Slc4a4 APN 5 89228935 missense probably damaging 1.00
IGL01487:Slc4a4 APN 5 89228856 missense probably benign 0.19
IGL02501:Slc4a4 APN 5 89129649 missense probably benign 0.13
IGL03104:Slc4a4 APN 5 89149372 missense probably damaging 1.00
IGL03157:Slc4a4 APN 5 89156513 missense probably damaging 0.99
IGL03205:Slc4a4 APN 5 89149330 missense probably benign 0.00
IGL03356:Slc4a4 APN 5 89122483 missense probably benign 0.00
IGL03372:Slc4a4 APN 5 89156426 missense probably damaging 1.00
IGL03382:Slc4a4 APN 5 89228836 missense probably damaging 1.00
camera UTSW 5 89132507 missense probably damaging 1.00
pixels UTSW 5 89122403 missense probably damaging 0.99
Shutter UTSW 5 89225948 missense probably damaging 1.00
Tetrapod UTSW 5 89228972 missense probably damaging 1.00
tripod UTSW 5 89149333 missense possibly damaging 0.52
PIT4515001:Slc4a4 UTSW 5 89133253 missense probably damaging 1.00
PIT4544001:Slc4a4 UTSW 5 89038543 missense probably damaging 1.00
R0007:Slc4a4 UTSW 5 89038578 missense probably damaging 1.00
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0054:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0055:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0230:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0632:Slc4a4 UTSW 5 89129641 missense probably damaging 1.00
R1199:Slc4a4 UTSW 5 89215794 critical splice donor site probably null
R1597:Slc4a4 UTSW 5 89135728 missense probably benign 0.01
R1783:Slc4a4 UTSW 5 89132414 missense probably damaging 1.00
R1813:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R1896:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R2000:Slc4a4 UTSW 5 89028347 missense probably damaging 1.00
R2139:Slc4a4 UTSW 5 89046264 missense probably damaging 1.00
R2163:Slc4a4 UTSW 5 89214576 missense probably damaging 1.00
R2513:Slc4a4 UTSW 5 89156398 missense probably benign 0.00
R2873:Slc4a4 UTSW 5 89135764 missense probably damaging 1.00
R2995:Slc4a4 UTSW 5 88934814 missense probably damaging 1.00
R3054:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89132507 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3056:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3617:Slc4a4 UTSW 5 89234804 missense probably benign 0.00
R3856:Slc4a4 UTSW 5 89232839 missense probably benign 0.00
R3863:Slc4a4 UTSW 5 89135648 missense possibly damaging 0.95
R3896:Slc4a4 UTSW 5 89197766 splice site probably benign
R4007:Slc4a4 UTSW 5 89214593 missense probably damaging 1.00
R4616:Slc4a4 UTSW 5 89038561 missense probably damaging 1.00
R4740:Slc4a4 UTSW 5 89225894 missense probably damaging 1.00
R5009:Slc4a4 UTSW 5 89149298 critical splice acceptor site probably null
R5119:Slc4a4 UTSW 5 88954862 missense probably null 0.97
R5228:Slc4a4 UTSW 5 89156525 missense possibly damaging 0.50
R5394:Slc4a4 UTSW 5 89197764 critical splice donor site probably null
R5396:Slc4a4 UTSW 5 89046217 missense probably benign 0.00
R5662:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R5664:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R6021:Slc4a4 UTSW 5 89040402 intron probably benign
R6088:Slc4a4 UTSW 5 89197704 missense probably benign 0.12
R6337:Slc4a4 UTSW 5 89046372 missense probably benign 0.21
R6416:Slc4a4 UTSW 5 89179729 missense probably benign 0.26
R6452:Slc4a4 UTSW 5 89228980 missense probably benign 0.05
R6524:Slc4a4 UTSW 5 89232764 missense probably benign 0.01
R6566:Slc4a4 UTSW 5 89149333 missense possibly damaging 0.52
R6727:Slc4a4 UTSW 5 89170765 missense probably benign 0.00
R6844:Slc4a4 UTSW 5 89228972 missense probably damaging 1.00
R6970:Slc4a4 UTSW 5 89179831 missense probably damaging 0.98
R7021:Slc4a4 UTSW 5 89040346 splice site probably null
R7197:Slc4a4 UTSW 5 88934574 intron probably benign
R7246:Slc4a4 UTSW 5 89122403 missense probably damaging 0.99
R7309:Slc4a4 UTSW 5 89170751 missense probably benign
R7412:Slc4a4 UTSW 5 89214647 synonymous probably null
R7492:Slc4a4 UTSW 5 89129650 missense possibly damaging 0.92
R7561:Slc4a4 UTSW 5 89199697 missense probably damaging 1.00
R7577:Slc4a4 UTSW 5 89225867 missense probably damaging 0.97
R7609:Slc4a4 UTSW 5 89135686 missense probably damaging 1.00
R7781:Slc4a4 UTSW 5 89228932 missense possibly damaging 0.78
Z1177:Slc4a4 UTSW 5 89132459
Predicted Primers PCR Primer
(F):5'- ATTAATGCCAGCATCCTGTCCC -3'
(R):5'- AATGACCATGGCGCGTGAAC -3'

Sequencing Primer
(F):5'- AGCATCCTGTCCCTTCCCATAAAG -3'
(R):5'- CATGGCGCGTGAACTTGAG -3'
Posted On2019-06-26