Incidental Mutation 'R7180:Idua'
ID558897
Institutional Source Beutler Lab
Gene Symbol Idua
Ensembl Gene ENSMUSG00000033540
Gene Nameiduronidase, alpha-L-
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7180 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108660331-108684557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108680895 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 335 (N335S)
Ref Sequence ENSEMBL: ENSMUSP00000071577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000139734] [ENSMUST00000140620]
Predicted Effect probably benign
Transcript: ENSMUST00000071650
AA Change: N335S

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540
AA Change: N335S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112563
AA Change: N335S

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540
AA Change: N335S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119212
AA Change: N288S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540
AA Change: N288S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139734
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140620
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Meta Mutation Damage Score 0.0890 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutants show lysosomal storage in multiple tissues, increased urinary GAG, craniofacial and skeletal defects, increased body weight, impaired habituation and long-term memory for aversive training, reduced ventricular function with valve insufficiency, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A C 4: 49,381,803 Y196* probably null Het
Agrn C T 4: 156,171,839 R1405H probably benign Het
Agtpbp1 G A 13: 59,466,038 H1030Y probably benign Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Ap1g2 G C 14: 55,104,451 P218R probably damaging Het
Ap2a1 C T 7: 44,923,804 probably null Het
Apc2 T A 10: 80,311,156 D681E possibly damaging Het
Arhgef5 T A 6: 43,275,208 N964K possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Ccnf T A 17: 24,223,915 M773L probably benign Het
Ces1e A C 8: 93,215,144 S234A probably damaging Het
Ces1g T A 8: 93,302,948 E552V probably benign Het
Ctcfl A T 2: 173,105,977 probably null Het
Dkk2 T A 3: 132,086,192 S54T probably damaging Het
Dll1 A G 17: 15,374,869 S49P probably benign Het
Dscam C A 16: 96,825,564 A382S probably damaging Het
Eif5b A T 1: 38,049,074 M1020L probably damaging Het
Enpp4 T C 17: 44,102,037 D202G probably benign Het
Eps8 A T 6: 137,479,074 I803N possibly damaging Het
Etv2 C A 7: 30,635,649 G28V probably damaging Het
Fadd A T 7: 144,580,785 V121E probably damaging Het
Fam149b T C 14: 20,381,785 Y545H probably benign Het
Fam196b A G 11: 34,419,873 K526E probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Flg2 T C 3: 93,202,833 S723P unknown Het
Gm4884 C T 7: 41,044,209 T534I possibly damaging Het
Gm8994 T A 6: 136,329,537 I332N probably damaging Het
Gpbar1 A T 1: 74,278,633 I12F possibly damaging Het
Gpr151 A T 18: 42,578,956 L219* probably null Het
Hdgfl2 T A 17: 56,097,532 probably null Het
Hectd4 A G 5: 121,308,342 M200V probably benign Het
Ifit1bl1 A T 19: 34,593,902 F385Y probably damaging Het
Ift172 T C 5: 31,254,262 D1624G probably damaging Het
Igsf9b A T 9: 27,322,668 T388S possibly damaging Het
Ikbkap A T 4: 56,796,535 S118R probably damaging Het
Jak2 A G 19: 29,282,411 I237V probably benign Het
Kat5 C A 19: 5,603,961 K398N probably damaging Het
Lmbrd2 T A 15: 9,175,196 V398E possibly damaging Het
Lrp1 T C 10: 127,556,965 N2744D probably damaging Het
Lrrd1 T C 5: 3,851,459 I588T probably damaging Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Magi1 T A 6: 93,815,750 D169V probably benign Het
Mpdz T C 4: 81,335,751 E1048G probably damaging Het
Myh9 T C 15: 77,807,910 I150V probably benign Het
Nckap1 A T 2: 80,506,892 M1006K probably benign Het
Nkain1 C T 4: 130,533,925 V132I probably benign Het
Npy6r A T 18: 44,276,156 M215L probably benign Het
Nr3c2 A T 8: 76,908,963 Q231L probably damaging Het
Obox5 C T 7: 15,757,924 P88L probably benign Het
Olfr514 A G 7: 108,825,979 S7P probably damaging Het
Olfr827 T C 10: 130,210,942 T63A probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Pdzd2 T A 15: 12,376,123 S1309C probably damaging Het
Pex5l C T 3: 33,024,691 probably null Het
Pip T A 6: 41,847,631 C18S probably damaging Het
Pla2g7 C T 17: 43,599,076 T157M probably damaging Het
Plce1 A G 19: 38,779,785 Y2168C probably damaging Het
Rgs2 T C 1: 144,002,148 T137A probably benign Het
Rpl32 T A 6: 115,807,807 I31F possibly damaging Het
Ryr2 T C 13: 11,686,978 Y2931C probably damaging Het
Slc4a4 G A 5: 89,046,236 E192K probably damaging Het
Slc4a7 G A 14: 14,765,580 A521T probably damaging Het
Smchd1 T C 17: 71,394,823 E1058G probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Ssc5d A G 7: 4,936,601 T679A probably benign Het
Tas2r130 A C 6: 131,630,248 S195A probably benign Het
Tas2r135 C T 6: 42,405,751 R75* probably null Het
Terf2ip G T 8: 112,011,420 probably benign Het
Tm6sf2 G A 8: 70,076,006 R136K probably benign Het
Tmprss15 A G 16: 78,967,998 L858P probably damaging Het
Topaz1 A G 9: 122,797,705 D1466G possibly damaging Het
Trip4 A T 9: 65,857,345 L446Q probably damaging Het
Trpv3 G T 11: 73,277,992 V93L probably benign Het
Ubl4b A T 3: 107,554,646 H99Q probably damaging Het
Unc45a A T 7: 80,329,821 probably null Het
Vmn1r47 G T 6: 90,022,353 A156S probably damaging Het
Vmn2r33 T A 7: 7,563,897 H72L probably benign Het
Zeb1 G A 18: 5,767,867 V793M possibly damaging Het
Zfp628 C A 7: 4,921,064 Q762K probably benign Het
Other mutations in Idua
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Idua APN 5 108680871 missense probably benign 0.34
IGL01575:Idua APN 5 108682107 missense possibly damaging 0.71
IGL02402:Idua APN 5 108679791 missense probably damaging 1.00
IGL03145:Idua APN 5 108681496 missense probably benign
cooper UTSW 5 108680314 missense probably damaging 1.00
R0208:Idua UTSW 5 108681752 missense probably damaging 1.00
R1572:Idua UTSW 5 108680589 missense probably benign
R1731:Idua UTSW 5 108681672 missense probably benign 0.00
R2024:Idua UTSW 5 108680734 missense probably damaging 1.00
R2126:Idua UTSW 5 108681438 missense possibly damaging 0.93
R3760:Idua UTSW 5 108670112 unclassified probably benign
R4747:Idua UTSW 5 108681036 missense probably damaging 0.97
R4832:Idua UTSW 5 108669381 missense probably benign
R5140:Idua UTSW 5 108680314 missense probably damaging 1.00
R5543:Idua UTSW 5 108670229 missense probably benign 0.22
R5643:Idua UTSW 5 108680224 utr 3 prime probably benign
R5821:Idua UTSW 5 108679734 missense probably benign 0.29
R6004:Idua UTSW 5 108680644 missense probably benign
R6330:Idua UTSW 5 108681708 missense probably benign 0.21
R6963:Idua UTSW 5 108679775 missense possibly damaging 0.84
R7453:Idua UTSW 5 108681496 missense probably benign
R7575:Idua UTSW 5 108681699 missense probably damaging 1.00
R7712:Idua UTSW 5 108681522 missense probably benign 0.10
R8026:Idua UTSW 5 108670249 missense probably benign 0.01
R8029:Idua UTSW 5 108669412 missense probably benign 0.23
R8074:Idua UTSW 5 108680575 missense possibly damaging 0.65
Z1177:Idua UTSW 5 108679584 missense probably null 0.80
Z1177:Idua UTSW 5 108680623 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGATGTGACTTATGCGGCC -3'
(R):5'- CTTTGTGACTCAGCACATACAG -3'

Sequencing Primer
(F):5'- ACTTATGCGGCCCTGGTG -3'
(R):5'- GGTCATTACTCACCCAACAGG -3'
Posted On2019-06-26