Incidental Mutation 'R0589:Abca8b'
ID55890
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene NameATP-binding cassette, sub-family A (ABC1), member 8b
SynonymsAbca8
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0589 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109932190-109995845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109942268 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1202 (A1202E)
Ref Sequence ENSEMBL: ENSMUSP00000102280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
Predicted Effect probably benign
Transcript: ENSMUST00000020948
AA Change: A1264E

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: A1264E

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106669
AA Change: A1202E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: A1202E

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149226
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Camk2a G A 18: 60,963,964 probably null Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Gpx3 A G 11: 54,909,503 I208V probably benign Het
Grk3 A G 5: 112,928,763 probably benign Het
Heatr9 T C 11: 83,514,690 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Marf1 C A 16: 14,142,055 probably benign Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr1220 A G 2: 89,097,262 F222L probably benign Het
Olfr531 T G 7: 140,400,900 S49R possibly damaging Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Pgbd1 G A 13: 21,434,430 T19I possibly damaging Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trem1 A G 17: 48,237,217 D90G possibly damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 intron probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
R7590:Abca8b UTSW 11 109938515 missense probably damaging 0.97
R7658:Abca8b UTSW 11 109935717 missense probably benign 0.00
R7739:Abca8b UTSW 11 109974591 missense probably benign 0.05
R7797:Abca8b UTSW 11 109971683 critical splice donor site probably null
R8074:Abca8b UTSW 11 109938494 missense probably benign
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Z1176:Abca8b UTSW 11 109961908 missense possibly damaging 0.52
Z1176:Abca8b UTSW 11 109974644 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGAAACACTGACTTTCAGTCTGCTC -3'
(R):5'- ACTAAGCATGGTGGTGCTGACAAG -3'

Sequencing Primer
(F):5'- GTCTGGTAGACCAGTTGCTTT -3'
(R):5'- TCACATGGGATGAATGCAGACTAC -3'
Posted On2013-07-11