Incidental Mutation 'R7180:Tas2r135'
ID558901
Institutional Source Beutler Lab
Gene Symbol Tas2r135
Ensembl Gene ENSMUSG00000056203
Gene Nametaste receptor, type 2, member 135
Synonymsmt2r38, Tas2r35
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R7180 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42405434-42406526 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 42405751 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 75 (R75*)
Ref Sequence ENSEMBL: ENSMUSP00000070247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057398] [ENSMUST00000070178]
Predicted Effect probably benign
Transcript: ENSMUST00000057398
SMART Domains Protein: ENSMUSP00000057910
Gene: ENSMUSG00000046652

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 6.7e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000070178
AA Change: R75*
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203
AA Change: R75*

DomainStartEndE-ValueType
Pfam:TAS2R 22 320 1.3e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A C 4: 49,381,803 Y196* probably null Het
Agrn C T 4: 156,171,839 R1405H probably benign Het
Agtpbp1 G A 13: 59,466,038 H1030Y probably benign Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Ap1g2 G C 14: 55,104,451 P218R probably damaging Het
Ap2a1 C T 7: 44,923,804 probably null Het
Apc2 T A 10: 80,311,156 D681E possibly damaging Het
Arhgef5 T A 6: 43,275,208 N964K possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Ccnf T A 17: 24,223,915 M773L probably benign Het
Ces1e A C 8: 93,215,144 S234A probably damaging Het
Ces1g T A 8: 93,302,948 E552V probably benign Het
Ctcfl A T 2: 173,105,977 probably null Het
Dkk2 T A 3: 132,086,192 S54T probably damaging Het
Dll1 A G 17: 15,374,869 S49P probably benign Het
Dscam C A 16: 96,825,564 A382S probably damaging Het
Eif5b A T 1: 38,049,074 M1020L probably damaging Het
Enpp4 T C 17: 44,102,037 D202G probably benign Het
Eps8 A T 6: 137,479,074 I803N possibly damaging Het
Etv2 C A 7: 30,635,649 G28V probably damaging Het
Fadd A T 7: 144,580,785 V121E probably damaging Het
Fam149b T C 14: 20,381,785 Y545H probably benign Het
Fam196b A G 11: 34,419,873 K526E probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Flg2 T C 3: 93,202,833 S723P unknown Het
Gm4884 C T 7: 41,044,209 T534I possibly damaging Het
Gm8994 T A 6: 136,329,537 I332N probably damaging Het
Gpbar1 A T 1: 74,278,633 I12F possibly damaging Het
Gpr151 A T 18: 42,578,956 L219* probably null Het
Hdgfl2 T A 17: 56,097,532 probably null Het
Hectd4 A G 5: 121,308,342 M200V probably benign Het
Idua A G 5: 108,680,895 N335S probably benign Het
Ifit1bl1 A T 19: 34,593,902 F385Y probably damaging Het
Ift172 T C 5: 31,254,262 D1624G probably damaging Het
Igsf9b A T 9: 27,322,668 T388S possibly damaging Het
Ikbkap A T 4: 56,796,535 S118R probably damaging Het
Jak2 A G 19: 29,282,411 I237V probably benign Het
Kat5 C A 19: 5,603,961 K398N probably damaging Het
Lmbrd2 T A 15: 9,175,196 V398E possibly damaging Het
Lrp1 T C 10: 127,556,965 N2744D probably damaging Het
Lrrd1 T C 5: 3,851,459 I588T probably damaging Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Magi1 T A 6: 93,815,750 D169V probably benign Het
Mpdz T C 4: 81,335,751 E1048G probably damaging Het
Myh9 T C 15: 77,807,910 I150V probably benign Het
Nckap1 A T 2: 80,506,892 M1006K probably benign Het
Nkain1 C T 4: 130,533,925 V132I probably benign Het
Npy6r A T 18: 44,276,156 M215L probably benign Het
Nr3c2 A T 8: 76,908,963 Q231L probably damaging Het
Obox5 C T 7: 15,757,924 P88L probably benign Het
Olfr514 A G 7: 108,825,979 S7P probably damaging Het
Olfr827 T C 10: 130,210,942 T63A probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Pdzd2 T A 15: 12,376,123 S1309C probably damaging Het
Pex5l C T 3: 33,024,691 probably null Het
Pip T A 6: 41,847,631 C18S probably damaging Het
Pla2g7 C T 17: 43,599,076 T157M probably damaging Het
Plce1 A G 19: 38,779,785 Y2168C probably damaging Het
Rgs2 T C 1: 144,002,148 T137A probably benign Het
Rpl32 T A 6: 115,807,807 I31F possibly damaging Het
Ryr2 T C 13: 11,686,978 Y2931C probably damaging Het
Slc4a4 G A 5: 89,046,236 E192K probably damaging Het
Slc4a7 G A 14: 14,765,580 A521T probably damaging Het
Smchd1 T C 17: 71,394,823 E1058G probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Ssc5d A G 7: 4,936,601 T679A probably benign Het
Tas2r130 A C 6: 131,630,248 S195A probably benign Het
Terf2ip G T 8: 112,011,420 probably benign Het
Tm6sf2 G A 8: 70,076,006 R136K probably benign Het
Tmprss15 A G 16: 78,967,998 L858P probably damaging Het
Topaz1 A G 9: 122,797,705 D1466G possibly damaging Het
Trip4 A T 9: 65,857,345 L446Q probably damaging Het
Trpv3 G T 11: 73,277,992 V93L probably benign Het
Ubl4b A T 3: 107,554,646 H99Q probably damaging Het
Unc45a A T 7: 80,329,821 probably null Het
Vmn1r47 G T 6: 90,022,353 A156S probably damaging Het
Vmn2r33 T A 7: 7,563,897 H72L probably benign Het
Zeb1 G A 18: 5,767,867 V793M possibly damaging Het
Zfp628 C A 7: 4,921,064 Q762K probably benign Het
Other mutations in Tas2r135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Tas2r135 APN 6 42406144 missense probably benign 0.00
IGL01395:Tas2r135 APN 6 42405912 nonsense probably null
IGL02479:Tas2r135 APN 6 42405751 nonsense probably null
IGL02526:Tas2r135 APN 6 42406280 missense probably damaging 1.00
IGL02806:Tas2r135 APN 6 42406448 missense probably benign 0.00
IGL02982:Tas2r135 APN 6 42406253 missense probably benign
IGL03057:Tas2r135 APN 6 42401127 unclassified probably benign
R0057:Tas2r135 UTSW 6 42406420 missense probably benign 0.07
R0104:Tas2r135 UTSW 6 42406324 missense possibly damaging 0.79
R1412:Tas2r135 UTSW 6 42405834 missense probably benign 0.00
R4517:Tas2r135 UTSW 6 42406079 missense probably benign
R4629:Tas2r135 UTSW 6 42406226 missense probably benign 0.03
R5788:Tas2r135 UTSW 6 42405597 missense probably damaging 1.00
R6021:Tas2r135 UTSW 6 42406387 missense probably damaging 1.00
R6586:Tas2r135 UTSW 6 42406018 missense probably benign 0.18
R7458:Tas2r135 UTSW 6 42405947 missense possibly damaging 0.95
R7850:Tas2r135 UTSW 6 42406138 missense probably benign
R7933:Tas2r135 UTSW 6 42406138 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCACAGGCCATACAGTTC -3'
(R):5'- CTTTAGCCAGACAAAGACAGGATG -3'

Sequencing Primer
(F):5'- ACAGTTCTTGGATGTCAGACTACTG -3'
(R):5'- GGGTTAAGGTTGCAATTTTCACAC -3'
Posted On2019-06-26