Incidental Mutation 'R0589:Pgbd1'
ID55891
Institutional Source Beutler Lab
Gene Symbol Pgbd1
Ensembl Gene ENSMUSG00000055313
Gene NamepiggyBac transposable element derived 1
Synonyms4921509E05Rik
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0589 (G1)
Quality Score135
Status Validated
Chromosome13
Chromosomal Location21421275-21441058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21434430 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 19 (T19I)
Ref Sequence ENSEMBL: ENSMUSP00000120175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099719] [ENSMUST00000122872] [ENSMUST00000145494] [ENSMUST00000148071] [ENSMUST00000151743]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099719
AA Change: T19I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097307
Gene: ENSMUSG00000055313
AA Change: T19I

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122872
AA Change: T19I

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120175
Gene: ENSMUSG00000055313
AA Change: T19I

DomainStartEndE-ValueType
Blast:SCAN 1 65 1e-13 BLAST
low complexity region 155 167 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 213 374 1.4e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145494
AA Change: T19I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118503
Gene: ENSMUSG00000055313
AA Change: T19I

DomainStartEndE-ValueType
Blast:SCAN 1 65 8e-15 BLAST
low complexity region 192 204 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148071
AA Change: T19I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114882
Gene: ENSMUSG00000055313
AA Change: T19I

DomainStartEndE-ValueType
Blast:SCAN 1 65 3e-16 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000151743
AA Change: T19I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117669
Gene: ENSMUSG00000055313
AA Change: T19I

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.7e-42 PFAM
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. This gene product is specifically expressed in the brain, however, its exact function is not known. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,942,268 A1202E probably damaging Het
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Camk2a G A 18: 60,963,964 probably null Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Gpx3 A G 11: 54,909,503 I208V probably benign Het
Grk3 A G 5: 112,928,763 probably benign Het
Heatr9 T C 11: 83,514,690 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Marf1 C A 16: 14,142,055 probably benign Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr1220 A G 2: 89,097,262 F222L probably benign Het
Olfr531 T G 7: 140,400,900 S49R possibly damaging Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trem1 A G 17: 48,237,217 D90G possibly damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Pgbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Pgbd1 APN 13 21423253 nonsense probably null
IGL03136:Pgbd1 APN 13 21433439 missense possibly damaging 0.46
R0206:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R0208:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R0420:Pgbd1 UTSW 13 21423166 missense possibly damaging 0.50
R0547:Pgbd1 UTSW 13 21423518 missense probably damaging 1.00
R0854:Pgbd1 UTSW 13 21423172 missense probably damaging 0.99
R0891:Pgbd1 UTSW 13 21422800 missense probably damaging 0.97
R1589:Pgbd1 UTSW 13 21423292 missense probably damaging 0.97
R1700:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R1815:Pgbd1 UTSW 13 21423172 missense probably damaging 0.99
R2139:Pgbd1 UTSW 13 21423020 missense probably damaging 1.00
R3776:Pgbd1 UTSW 13 21428373 missense probably benign 0.00
R3870:Pgbd1 UTSW 13 21434370 missense possibly damaging 0.95
R3871:Pgbd1 UTSW 13 21434370 missense possibly damaging 0.95
R4580:Pgbd1 UTSW 13 21428329 missense probably benign 0.07
R5644:Pgbd1 UTSW 13 21423152 missense probably damaging 0.99
R6480:Pgbd1 UTSW 13 21423476 missense probably benign 0.13
R6978:Pgbd1 UTSW 13 21423262 missense probably damaging 1.00
R7084:Pgbd1 UTSW 13 21423130 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CCGGGGAAAGTCTGCATAACTGTG -3'
(R):5'- CTGGGTTCTGCTCCTGAGAATGAAG -3'

Sequencing Primer
(F):5'- TCATGGAACCAGTGTTACCAAG -3'
(R):5'- AATGAAGGCCGCCTTGTG -3'
Posted On2013-07-11