Incidental Mutation 'R7180:Ap1g2'
ID558936
Institutional Source Beutler Lab
Gene Symbol Ap1g2
Ensembl Gene ENSMUSG00000040701
Gene Nameadaptor protein complex AP-1, gamma 2 subunit
Synonymsgamma 2-adaptin, Adtg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R7180 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55098575-55106593 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 55104451 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 218 (P218R)
Ref Sequence ENSEMBL: ENSMUSP00000043996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022819] [ENSMUST00000036041] [ENSMUST00000124493] [ENSMUST00000127870] [ENSMUST00000131323] [ENSMUST00000151314] [ENSMUST00000170285]
Predicted Effect probably benign
Transcript: ENSMUST00000022819
SMART Domains Protein: ENSMUSP00000022819
Gene: ENSMUSG00000022208

DomainStartEndE-ValueType
MORN 13 34 1.63e0 SMART
MORN 59 80 1.62e-1 SMART
MORN 104 125 4.76e-2 SMART
MORN 127 148 5.26e-4 SMART
low complexity region 170 180 N/A INTRINSIC
low complexity region 216 246 N/A INTRINSIC
MORN 280 301 1.37e-2 SMART
MORN 303 324 3.29e-5 SMART
low complexity region 367 406 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
low complexity region 528 553 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000036041
AA Change: P218R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043996
Gene: ENSMUSG00000040701
AA Change: P218R

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 2.7e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124493
SMART Domains Protein: ENSMUSP00000121893
Gene: ENSMUSG00000022208

DomainStartEndE-ValueType
MORN 13 34 1.63e0 SMART
MORN 59 80 1.62e-1 SMART
MORN 104 125 4.76e-2 SMART
MORN 127 148 5.26e-4 SMART
low complexity region 170 180 N/A INTRINSIC
low complexity region 216 246 N/A INTRINSIC
MORN 280 301 1.37e-2 SMART
MORN 303 324 3.29e-5 SMART
low complexity region 367 406 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
low complexity region 528 553 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000127870
SMART Domains Protein: ENSMUSP00000116698
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000131323
SMART Domains Protein: ENSMUSP00000115441
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000151314
SMART Domains Protein: ENSMUSP00000122796
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170285
AA Change: P218R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128427
Gene: ENSMUSG00000040701
AA Change: P218R

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 1.5e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene encodes the gamma-2 subunit of the adaptor protein complex 1 (AP-1). AP-1 complex is a heterotetramer comprised of two heavy and one each of medium and small subunits. The encoded protein is a heavy subunit of AP-1 complex that regulates polarized sorting of cargo at the trans-Golgi network and endosomes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A C 4: 49,381,803 Y196* probably null Het
Agrn C T 4: 156,171,839 R1405H probably benign Het
Agtpbp1 G A 13: 59,466,038 H1030Y probably benign Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Ap2a1 C T 7: 44,923,804 probably null Het
Apc2 T A 10: 80,311,156 D681E possibly damaging Het
Arhgef5 T A 6: 43,275,208 N964K possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Ccnf T A 17: 24,223,915 M773L probably benign Het
Ces1e A C 8: 93,215,144 S234A probably damaging Het
Ces1g T A 8: 93,302,948 E552V probably benign Het
Ctcfl A T 2: 173,105,977 probably null Het
Dkk2 T A 3: 132,086,192 S54T probably damaging Het
Dll1 A G 17: 15,374,869 S49P probably benign Het
Dscam C A 16: 96,825,564 A382S probably damaging Het
Eif5b A T 1: 38,049,074 M1020L probably damaging Het
Enpp4 T C 17: 44,102,037 D202G probably benign Het
Eps8 A T 6: 137,479,074 I803N possibly damaging Het
Etv2 C A 7: 30,635,649 G28V probably damaging Het
Fadd A T 7: 144,580,785 V121E probably damaging Het
Fam149b T C 14: 20,381,785 Y545H probably benign Het
Fam196b A G 11: 34,419,873 K526E probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Flg2 T C 3: 93,202,833 S723P unknown Het
Gm4884 C T 7: 41,044,209 T534I possibly damaging Het
Gm8994 T A 6: 136,329,537 I332N probably damaging Het
Gpbar1 A T 1: 74,278,633 I12F possibly damaging Het
Gpr151 A T 18: 42,578,956 L219* probably null Het
Hdgfl2 T A 17: 56,097,532 probably null Het
Hectd4 A G 5: 121,308,342 M200V probably benign Het
Idua A G 5: 108,680,895 N335S probably benign Het
Ifit1bl1 A T 19: 34,593,902 F385Y probably damaging Het
Ift172 T C 5: 31,254,262 D1624G probably damaging Het
Igsf9b A T 9: 27,322,668 T388S possibly damaging Het
Ikbkap A T 4: 56,796,535 S118R probably damaging Het
Jak2 A G 19: 29,282,411 I237V probably benign Het
Kat5 C A 19: 5,603,961 K398N probably damaging Het
Lmbrd2 T A 15: 9,175,196 V398E possibly damaging Het
Lrp1 T C 10: 127,556,965 N2744D probably damaging Het
Lrrd1 T C 5: 3,851,459 I588T probably damaging Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Magi1 T A 6: 93,815,750 D169V probably benign Het
Mpdz T C 4: 81,335,751 E1048G probably damaging Het
Myh9 T C 15: 77,807,910 I150V probably benign Het
Nckap1 A T 2: 80,506,892 M1006K probably benign Het
Nkain1 C T 4: 130,533,925 V132I probably benign Het
Npy6r A T 18: 44,276,156 M215L probably benign Het
Nr3c2 A T 8: 76,908,963 Q231L probably damaging Het
Obox5 C T 7: 15,757,924 P88L probably benign Het
Olfr514 A G 7: 108,825,979 S7P probably damaging Het
Olfr827 T C 10: 130,210,942 T63A probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Pdzd2 T A 15: 12,376,123 S1309C probably damaging Het
Pex5l C T 3: 33,024,691 probably null Het
Pip T A 6: 41,847,631 C18S probably damaging Het
Pla2g7 C T 17: 43,599,076 T157M probably damaging Het
Plce1 A G 19: 38,779,785 Y2168C probably damaging Het
Rgs2 T C 1: 144,002,148 T137A probably benign Het
Rpl32 T A 6: 115,807,807 I31F possibly damaging Het
Ryr2 T C 13: 11,686,978 Y2931C probably damaging Het
Slc4a4 G A 5: 89,046,236 E192K probably damaging Het
Slc4a7 G A 14: 14,765,580 A521T probably damaging Het
Smchd1 T C 17: 71,394,823 E1058G probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Ssc5d A G 7: 4,936,601 T679A probably benign Het
Tas2r130 A C 6: 131,630,248 S195A probably benign Het
Tas2r135 C T 6: 42,405,751 R75* probably null Het
Terf2ip G T 8: 112,011,420 probably benign Het
Tm6sf2 G A 8: 70,076,006 R136K probably benign Het
Tmprss15 A G 16: 78,967,998 L858P probably damaging Het
Topaz1 A G 9: 122,797,705 D1466G possibly damaging Het
Trip4 A T 9: 65,857,345 L446Q probably damaging Het
Trpv3 G T 11: 73,277,992 V93L probably benign Het
Ubl4b A T 3: 107,554,646 H99Q probably damaging Het
Unc45a A T 7: 80,329,821 probably null Het
Vmn1r47 G T 6: 90,022,353 A156S probably damaging Het
Vmn2r33 T A 7: 7,563,897 H72L probably benign Het
Zeb1 G A 18: 5,767,867 V793M possibly damaging Het
Zfp628 C A 7: 4,921,064 Q762K probably benign Het
Other mutations in Ap1g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ap1g2 APN 14 55105114 missense probably benign 0.01
IGL02421:Ap1g2 APN 14 55102402 missense probably damaging 1.00
IGL02633:Ap1g2 APN 14 55100647 splice site probably null
IGL02967:Ap1g2 APN 14 55105022 splice site probably benign
IGL03030:Ap1g2 APN 14 55106047 missense probably damaging 1.00
IGL03087:Ap1g2 APN 14 55103036 missense probably damaging 0.99
IGL03261:Ap1g2 APN 14 55100530 missense probably benign 0.00
IGL03308:Ap1g2 APN 14 55104876 missense probably benign 0.44
R0284:Ap1g2 UTSW 14 55101692 splice site probably benign
R0614:Ap1g2 UTSW 14 55099773 missense probably benign 0.00
R0762:Ap1g2 UTSW 14 55100411 splice site probably benign
R1561:Ap1g2 UTSW 14 55104887 missense probably damaging 1.00
R1889:Ap1g2 UTSW 14 55101429 missense probably damaging 1.00
R1938:Ap1g2 UTSW 14 55099772 missense possibly damaging 0.80
R1997:Ap1g2 UTSW 14 55102378 missense probably benign 0.00
R2169:Ap1g2 UTSW 14 55099340 critical splice acceptor site probably null
R3157:Ap1g2 UTSW 14 55099274 missense probably damaging 0.96
R3820:Ap1g2 UTSW 14 55100573 splice site probably benign
R3850:Ap1g2 UTSW 14 55104906 missense probably benign 0.03
R4750:Ap1g2 UTSW 14 55104365 missense probably damaging 1.00
R4909:Ap1g2 UTSW 14 55105026 critical splice donor site probably null
R5305:Ap1g2 UTSW 14 55099076 missense probably benign
R5880:Ap1g2 UTSW 14 55102700 missense probably damaging 1.00
R6243:Ap1g2 UTSW 14 55099073 missense probably benign
R6964:Ap1g2 UTSW 14 55099265 missense possibly damaging 0.85
R7039:Ap1g2 UTSW 14 55102654 nonsense probably null
R7563:Ap1g2 UTSW 14 55099749 missense probably damaging 1.00
R7818:Ap1g2 UTSW 14 55099724 missense probably benign 0.44
R7854:Ap1g2 UTSW 14 55105933 missense probably damaging 1.00
R7937:Ap1g2 UTSW 14 55105933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAGTCTTACGATGACTAG -3'
(R):5'- GTGAAAGAAACCCTGCAGCC -3'

Sequencing Primer
(F):5'- GACTAGAGCAATCCTGAGTTTGC -3'
(R):5'- CCTCAGGCACTTTCGCAAG -3'
Posted On2019-06-26