Incidental Mutation 'R7180:Dscam'
ID558942
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene NameDS cell adhesion molecule
Synonyms4932410A21Rik
MMRRC Submission
Accession Numbers

Genbank: NM_031174; MGI: 1196281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7180 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location96592079-97170752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96825564 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 382 (A382S)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
Predicted Effect probably damaging
Transcript: ENSMUST00000056102
AA Change: A382S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: A382S

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A C 4: 49,381,803 Y196* probably null Het
Agrn C T 4: 156,171,839 R1405H probably benign Het
Agtpbp1 G A 13: 59,466,038 H1030Y probably benign Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Ap1g2 G C 14: 55,104,451 P218R probably damaging Het
Ap2a1 C T 7: 44,923,804 probably null Het
Apc2 T A 10: 80,311,156 D681E possibly damaging Het
Arhgef5 T A 6: 43,275,208 N964K possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Ccnf T A 17: 24,223,915 M773L probably benign Het
Ces1e A C 8: 93,215,144 S234A probably damaging Het
Ces1g T A 8: 93,302,948 E552V probably benign Het
Ctcfl A T 2: 173,105,977 probably null Het
Dkk2 T A 3: 132,086,192 S54T probably damaging Het
Dll1 A G 17: 15,374,869 S49P probably benign Het
Eif5b A T 1: 38,049,074 M1020L probably damaging Het
Enpp4 T C 17: 44,102,037 D202G probably benign Het
Eps8 A T 6: 137,479,074 I803N possibly damaging Het
Etv2 C A 7: 30,635,649 G28V probably damaging Het
Fadd A T 7: 144,580,785 V121E probably damaging Het
Fam149b T C 14: 20,381,785 Y545H probably benign Het
Fam196b A G 11: 34,419,873 K526E probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Flg2 T C 3: 93,202,833 S723P unknown Het
Gm4884 C T 7: 41,044,209 T534I possibly damaging Het
Gm8994 T A 6: 136,329,537 I332N probably damaging Het
Gpbar1 A T 1: 74,278,633 I12F possibly damaging Het
Gpr151 A T 18: 42,578,956 L219* probably null Het
Hdgfl2 T A 17: 56,097,532 probably null Het
Hectd4 A G 5: 121,308,342 M200V probably benign Het
Idua A G 5: 108,680,895 N335S probably benign Het
Ifit1bl1 A T 19: 34,593,902 F385Y probably damaging Het
Ift172 T C 5: 31,254,262 D1624G probably damaging Het
Igsf9b A T 9: 27,322,668 T388S possibly damaging Het
Ikbkap A T 4: 56,796,535 S118R probably damaging Het
Jak2 A G 19: 29,282,411 I237V probably benign Het
Kat5 C A 19: 5,603,961 K398N probably damaging Het
Lmbrd2 T A 15: 9,175,196 V398E possibly damaging Het
Lrp1 T C 10: 127,556,965 N2744D probably damaging Het
Lrrd1 T C 5: 3,851,459 I588T probably damaging Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Magi1 T A 6: 93,815,750 D169V probably benign Het
Mpdz T C 4: 81,335,751 E1048G probably damaging Het
Myh9 T C 15: 77,807,910 I150V probably benign Het
Nckap1 A T 2: 80,506,892 M1006K probably benign Het
Nkain1 C T 4: 130,533,925 V132I probably benign Het
Npy6r A T 18: 44,276,156 M215L probably benign Het
Nr3c2 A T 8: 76,908,963 Q231L probably damaging Het
Obox5 C T 7: 15,757,924 P88L probably benign Het
Olfr514 A G 7: 108,825,979 S7P probably damaging Het
Olfr827 T C 10: 130,210,942 T63A probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Pdzd2 T A 15: 12,376,123 S1309C probably damaging Het
Pex5l C T 3: 33,024,691 probably null Het
Pip T A 6: 41,847,631 C18S probably damaging Het
Pla2g7 C T 17: 43,599,076 T157M probably damaging Het
Plce1 A G 19: 38,779,785 Y2168C probably damaging Het
Rgs2 T C 1: 144,002,148 T137A probably benign Het
Rpl32 T A 6: 115,807,807 I31F possibly damaging Het
Ryr2 T C 13: 11,686,978 Y2931C probably damaging Het
Slc4a4 G A 5: 89,046,236 E192K probably damaging Het
Slc4a7 G A 14: 14,765,580 A521T probably damaging Het
Smchd1 T C 17: 71,394,823 E1058G probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Ssc5d A G 7: 4,936,601 T679A probably benign Het
Tas2r130 A C 6: 131,630,248 S195A probably benign Het
Tas2r135 C T 6: 42,405,751 R75* probably null Het
Terf2ip G T 8: 112,011,420 probably benign Het
Tm6sf2 G A 8: 70,076,006 R136K probably benign Het
Tmprss15 A G 16: 78,967,998 L858P probably damaging Het
Topaz1 A G 9: 122,797,705 D1466G possibly damaging Het
Trip4 A T 9: 65,857,345 L446Q probably damaging Het
Trpv3 G T 11: 73,277,992 V93L probably benign Het
Ubl4b A T 3: 107,554,646 H99Q probably damaging Het
Unc45a A T 7: 80,329,821 probably null Het
Vmn1r47 G T 6: 90,022,353 A156S probably damaging Het
Vmn2r33 T A 7: 7,563,897 H72L probably benign Het
Zeb1 G A 18: 5,767,867 V793M possibly damaging Het
Zfp628 C A 7: 4,921,064 Q762K probably benign Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1440:Dscam UTSW 16 96819951 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R1933:Dscam UTSW 16 96593214 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2101:Dscam UTSW 16 96610349 missense probably benign 0.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4575:Dscam UTSW 16 96825623 missense possibly damaging 0.82
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5666:Dscam UTSW 16 96718164 missense probably benign 0.23
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6257:Dscam UTSW 16 96673714 missense possibly damaging 0.94
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7209:Dscam UTSW 16 96650344 intron probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 intron probably null
R7624:Dscam UTSW 16 96610324 missense probably damaging 1.00
R7766:Dscam UTSW 16 96790901 missense probably benign 0.31
R7817:Dscam UTSW 16 96640864 missense probably benign
R7843:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7911:Dscam UTSW 16 96643922 missense probably benign 0.01
R7926:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7961:Dscam UTSW 16 96709421 intron probably null
R7992:Dscam UTSW 16 96643922 missense probably benign 0.01
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGGCAACACTGTTCCACC -3'
(R):5'- TTAACTCCCCAGAGCCACTG -3'

Sequencing Primer
(F):5'- GCCTCATCTATGGAGATTAGAGTCAC -3'
(R):5'- TCAGTCCCAGAAAGGTTAAAAGC -3'
Posted On2019-06-26