Incidental Mutation 'R7180:Sorbs1'
ID558955
Institutional Source Beutler Lab
Gene Symbol Sorbs1
Ensembl Gene ENSMUSG00000025006
Gene Namesorbin and SH3 domain containing 1
Synonyms9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R7180 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40294753-40513779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 40376800 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 180 (R180G)
Ref Sequence ENSEMBL: ENSMUSP00000153313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224233] [ENSMUST00000224247] [ENSMUST00000224583] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]
Predicted Effect probably benign
Transcript: ENSMUST00000099466
SMART Domains Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 203 249 1.07e-26 SMART
SH3 502 557 2.72e-18 SMART
SH3 576 633 9.32e-17 SMART
low complexity region 647 660 N/A INTRINSIC
SH3 682 739 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099467
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: R180G

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 192 213 N/A INTRINSIC
Sorb 327 373 1.24e-22 SMART
coiled coil region 558 584 N/A INTRINSIC
SH3 700 755 2.72e-18 SMART
SH3 774 831 9.32e-17 SMART
low complexity region 845 858 N/A INTRINSIC
SH3 880 937 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165212
SMART Domains Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 193 239 1.07e-26 SMART
SH3 486 541 2.72e-18 SMART
SH3 560 617 9.32e-17 SMART
low complexity region 631 644 N/A INTRINSIC
SH3 666 723 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165469
SMART Domains Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 75 93 N/A INTRINSIC
Sorb 233 279 1.07e-26 SMART
SH3 476 531 2.72e-18 SMART
SH3 550 607 9.32e-17 SMART
low complexity region 621 634 N/A INTRINSIC
SH3 656 713 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224233
Predicted Effect probably benign
Transcript: ENSMUST00000224247
Predicted Effect probably benign
Transcript: ENSMUST00000224583
Predicted Effect probably benign
Transcript: ENSMUST00000224667
Predicted Effect probably benign
Transcript: ENSMUST00000225148
Predicted Effect probably benign
Transcript: ENSMUST00000225153
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225786
Predicted Effect probably benign
Transcript: ENSMUST00000226047
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A C 4: 49,381,803 Y196* probably null Het
Agrn C T 4: 156,171,839 R1405H probably benign Het
Agtpbp1 G A 13: 59,466,038 H1030Y probably benign Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Ap1g2 G C 14: 55,104,451 P218R probably damaging Het
Ap2a1 C T 7: 44,923,804 probably null Het
Apc2 T A 10: 80,311,156 D681E possibly damaging Het
Arhgef5 T A 6: 43,275,208 N964K possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Ccnf T A 17: 24,223,915 M773L probably benign Het
Ces1e A C 8: 93,215,144 S234A probably damaging Het
Ces1g T A 8: 93,302,948 E552V probably benign Het
Ctcfl A T 2: 173,105,977 probably null Het
Dkk2 T A 3: 132,086,192 S54T probably damaging Het
Dll1 A G 17: 15,374,869 S49P probably benign Het
Dscam C A 16: 96,825,564 A382S probably damaging Het
Eif5b A T 1: 38,049,074 M1020L probably damaging Het
Enpp4 T C 17: 44,102,037 D202G probably benign Het
Eps8 A T 6: 137,479,074 I803N possibly damaging Het
Etv2 C A 7: 30,635,649 G28V probably damaging Het
Fadd A T 7: 144,580,785 V121E probably damaging Het
Fam149b T C 14: 20,381,785 Y545H probably benign Het
Fam196b A G 11: 34,419,873 K526E probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Flg2 T C 3: 93,202,833 S723P unknown Het
Gm4884 C T 7: 41,044,209 T534I possibly damaging Het
Gm8994 T A 6: 136,329,537 I332N probably damaging Het
Gpbar1 A T 1: 74,278,633 I12F possibly damaging Het
Gpr151 A T 18: 42,578,956 L219* probably null Het
Hdgfl2 T A 17: 56,097,532 probably null Het
Hectd4 A G 5: 121,308,342 M200V probably benign Het
Idua A G 5: 108,680,895 N335S probably benign Het
Ifit1bl1 A T 19: 34,593,902 F385Y probably damaging Het
Ift172 T C 5: 31,254,262 D1624G probably damaging Het
Igsf9b A T 9: 27,322,668 T388S possibly damaging Het
Ikbkap A T 4: 56,796,535 S118R probably damaging Het
Jak2 A G 19: 29,282,411 I237V probably benign Het
Kat5 C A 19: 5,603,961 K398N probably damaging Het
Lmbrd2 T A 15: 9,175,196 V398E possibly damaging Het
Lrp1 T C 10: 127,556,965 N2744D probably damaging Het
Lrrd1 T C 5: 3,851,459 I588T probably damaging Het
Ltn1 A G 16: 87,418,494 F418L probably damaging Het
Magi1 T A 6: 93,815,750 D169V probably benign Het
Mpdz T C 4: 81,335,751 E1048G probably damaging Het
Myh9 T C 15: 77,807,910 I150V probably benign Het
Nckap1 A T 2: 80,506,892 M1006K probably benign Het
Nkain1 C T 4: 130,533,925 V132I probably benign Het
Npy6r A T 18: 44,276,156 M215L probably benign Het
Nr3c2 A T 8: 76,908,963 Q231L probably damaging Het
Obox5 C T 7: 15,757,924 P88L probably benign Het
Olfr514 A G 7: 108,825,979 S7P probably damaging Het
Olfr827 T C 10: 130,210,942 T63A probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Pdzd2 T A 15: 12,376,123 S1309C probably damaging Het
Pex5l C T 3: 33,024,691 probably null Het
Pip T A 6: 41,847,631 C18S probably damaging Het
Pla2g7 C T 17: 43,599,076 T157M probably damaging Het
Plce1 A G 19: 38,779,785 Y2168C probably damaging Het
Rgs2 T C 1: 144,002,148 T137A probably benign Het
Rpl32 T A 6: 115,807,807 I31F possibly damaging Het
Ryr2 T C 13: 11,686,978 Y2931C probably damaging Het
Slc4a4 G A 5: 89,046,236 E192K probably damaging Het
Slc4a7 G A 14: 14,765,580 A521T probably damaging Het
Smchd1 T C 17: 71,394,823 E1058G probably damaging Het
Ssc5d A G 7: 4,936,601 T679A probably benign Het
Tas2r130 A C 6: 131,630,248 S195A probably benign Het
Tas2r135 C T 6: 42,405,751 R75* probably null Het
Terf2ip G T 8: 112,011,420 probably benign Het
Tm6sf2 G A 8: 70,076,006 R136K probably benign Het
Tmprss15 A G 16: 78,967,998 L858P probably damaging Het
Topaz1 A G 9: 122,797,705 D1466G possibly damaging Het
Trip4 A T 9: 65,857,345 L446Q probably damaging Het
Trpv3 G T 11: 73,277,992 V93L probably benign Het
Ubl4b A T 3: 107,554,646 H99Q probably damaging Het
Unc45a A T 7: 80,329,821 probably null Het
Vmn1r47 G T 6: 90,022,353 A156S probably damaging Het
Vmn2r33 T A 7: 7,563,897 H72L probably benign Het
Zeb1 G A 18: 5,767,867 V793M possibly damaging Het
Zfp628 C A 7: 4,921,064 Q762K probably benign Het
Other mutations in Sorbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sorbs1 APN 19 40318029 missense probably damaging 1.00
IGL00776:Sorbs1 APN 19 40344351 splice site probably null
IGL00788:Sorbs1 APN 19 40337043 splice site probably benign
IGL00943:Sorbs1 APN 19 40295040 utr 3 prime probably benign
IGL01525:Sorbs1 APN 19 40349978 missense probably damaging 1.00
IGL01530:Sorbs1 APN 19 40376647 missense probably benign 0.01
IGL01951:Sorbs1 APN 19 40318016 splice site probably benign
IGL02159:Sorbs1 APN 19 40327596 missense probably damaging 0.96
IGL02252:Sorbs1 APN 19 40314397 missense probably damaging 1.00
IGL02613:Sorbs1 APN 19 40327547 missense probably damaging 1.00
IGL02643:Sorbs1 APN 19 40365133 missense possibly damaging 0.65
IGL02668:Sorbs1 APN 19 40314681 missense probably damaging 1.00
IGL02738:Sorbs1 APN 19 40376904 missense probably damaging 0.97
IGL02965:Sorbs1 APN 19 40376743 missense probably benign 0.01
IGL03083:Sorbs1 APN 19 40314376 missense probably damaging 1.00
IGL03173:Sorbs1 APN 19 40363262 missense probably damaging 1.00
IGL03286:Sorbs1 APN 19 40344414 missense probably damaging 0.99
IGL03292:Sorbs1 APN 19 40373565 missense possibly damaging 0.79
R0016:Sorbs1 UTSW 19 40314738 splice site probably benign
R0016:Sorbs1 UTSW 19 40314738 splice site probably benign
R0306:Sorbs1 UTSW 19 40344411 missense possibly damaging 0.94
R0526:Sorbs1 UTSW 19 40349948 missense probably damaging 1.00
R0551:Sorbs1 UTSW 19 40311816 missense probably damaging 1.00
R0688:Sorbs1 UTSW 19 40363262 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1891:Sorbs1 UTSW 19 40393460 missense probably damaging 0.99
R2066:Sorbs1 UTSW 19 40365028 unclassified probably null
R2148:Sorbs1 UTSW 19 40376824 missense possibly damaging 0.94
R2214:Sorbs1 UTSW 19 40296631 missense probably damaging 1.00
R2410:Sorbs1 UTSW 19 40373515 missense probably damaging 0.99
R2940:Sorbs1 UTSW 19 40373571 missense probably damaging 1.00
R3847:Sorbs1 UTSW 19 40314443 missense probably damaging 0.97
R4405:Sorbs1 UTSW 19 40395745 missense probably benign 0.03
R4544:Sorbs1 UTSW 19 40311850 missense probably damaging 0.99
R4618:Sorbs1 UTSW 19 40373518 missense probably damaging 0.99
R4731:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4732:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4733:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4860:Sorbs1 UTSW 19 40337005 missense probably benign 0.44
R4860:Sorbs1 UTSW 19 40337005 missense probably benign 0.44
R4907:Sorbs1 UTSW 19 40340047 nonsense probably null
R4912:Sorbs1 UTSW 19 40311727 missense probably damaging 1.00
R5229:Sorbs1 UTSW 19 40340707 missense probably damaging 1.00
R5285:Sorbs1 UTSW 19 40321890 missense probably damaging 1.00
R5416:Sorbs1 UTSW 19 40376989 missense probably benign 0.06
R5706:Sorbs1 UTSW 19 40376881 missense probably benign
R5871:Sorbs1 UTSW 19 40398583 missense probably damaging 1.00
R5936:Sorbs1 UTSW 19 40324772 missense probably damaging 0.96
R6073:Sorbs1 UTSW 19 40314657 missense probably damaging 1.00
R6324:Sorbs1 UTSW 19 40321819 missense probably damaging 0.99
R6343:Sorbs1 UTSW 19 40376982 critical splice donor site probably null
R6561:Sorbs1 UTSW 19 40326052 missense probably benign
R6646:Sorbs1 UTSW 19 40325549 missense probably damaging 1.00
R6768:Sorbs1 UTSW 19 40327547 missense probably damaging 1.00
R6849:Sorbs1 UTSW 19 40376800 missense probably benign
R6850:Sorbs1 UTSW 19 40376800 missense probably benign
R6878:Sorbs1 UTSW 19 40376800 missense probably benign
R6879:Sorbs1 UTSW 19 40376800 missense probably benign
R6880:Sorbs1 UTSW 19 40376800 missense probably benign
R6908:Sorbs1 UTSW 19 40352332 missense probably damaging 1.00
R6980:Sorbs1 UTSW 19 40327616 nonsense probably null
R7040:Sorbs1 UTSW 19 40376800 missense probably benign
R7041:Sorbs1 UTSW 19 40376800 missense probably benign
R7110:Sorbs1 UTSW 19 40376800 missense probably benign
R7122:Sorbs1 UTSW 19 40376800 missense probably benign
R7170:Sorbs1 UTSW 19 40326129 nonsense probably null
R7185:Sorbs1 UTSW 19 40376800 missense probably benign
R7187:Sorbs1 UTSW 19 40376800 missense probably benign
R7254:Sorbs1 UTSW 19 40376800 missense probably benign
R7255:Sorbs1 UTSW 19 40376800 missense probably benign
R7401:Sorbs1 UTSW 19 40376800 missense probably benign
R7595:Sorbs1 UTSW 19 40314653 missense probably damaging 0.99
R7819:Sorbs1 UTSW 19 40376800 missense probably benign
R7876:Sorbs1 UTSW 19 40296588 missense probably damaging 1.00
R7894:Sorbs1 UTSW 19 40327576 missense probably benign 0.02
R7959:Sorbs1 UTSW 19 40296588 missense probably damaging 1.00
R7977:Sorbs1 UTSW 19 40327576 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGCAGACATTCAGGGTAGC -3'
(R):5'- AGCCCCGTCTGAGGTAATAG -3'

Sequencing Primer
(F):5'- ACATTCAGGGTAGCCGTGG -3'
(R):5'- CCCCGTCTGAGGTAATAGTTGTTC -3'
Posted On2019-06-26