Incidental Mutation 'R7181:Prex1'
ID558963
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
SynonymsP-REX1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R7181 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location166566342-166713832 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 166570371 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1568 (A1568V)
Ref Sequence ENSEMBL: ENSMUSP00000037180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080] [ENSMUST00000109246]
Predicted Effect probably damaging
Transcript: ENSMUST00000036719
AA Change: A1568V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: A1568V

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099080
AA Change: A1398V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: A1398V

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109246
AA Change: A380V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104869
Gene: ENSMUSG00000039621
AA Change: A380V

DomainStartEndE-ValueType
low complexity region 357 367 N/A INTRINSIC
Meta Mutation Damage Score 0.8208 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,881,037 N182D probably benign Het
Adgrl1 A G 8: 83,926,249 probably null Het
Adm T C 7: 110,629,029 I139T probably damaging Het
Ahnak A T 19: 9,013,488 K4045N probably damaging Het
Axin1 T A 17: 26,173,778 S344R probably damaging Het
Cacna1g T C 11: 94,415,865 S1896G probably benign Het
Cd209c A G 8: 3,945,712 V30A probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdh8 A T 8: 99,098,925 M520K probably benign Het
Cyp2b23 G A 7: 26,674,403 T306I probably damaging Het
Dnajc10 T G 2: 80,319,243 Y96* probably null Het
Elmod1 A C 9: 53,934,098 probably null Het
Eva1b A G 4: 126,149,653 H162R possibly damaging Het
Fam222b A T 11: 78,154,978 N455I probably damaging Het
Fer1l6 G A 15: 58,575,297 A626T probably benign Het
Fgd6 A G 10: 94,043,511 T76A probably benign Het
Fndc7 A G 3: 108,881,324 probably null Het
Gabrg2 T A 11: 41,920,434 I295F probably damaging Het
Gm10406 A T 14: 7,027,359 probably null Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm47189 T C 14: 41,770,102 M73V probably benign Het
Gm9758 A T 5: 14,913,653 S54T probably damaging Het
Gm9857 A G 3: 108,940,238 S70P unknown Het
Gsap A T 5: 21,253,429 E470D probably damaging Het
Hesx1 T A 14: 27,000,721 M1K probably null Het
Hirip3 A G 7: 126,864,063 D397G probably damaging Het
Kalrn T A 16: 34,163,077 N13I probably benign Het
Mettl8 A T 2: 70,973,362 S194T possibly damaging Het
Mrps35 T G 6: 147,055,993 probably null Het
Myrfl G T 10: 116,861,543 N25K probably damaging Het
Olfr57 A G 10: 79,035,453 Y219C probably damaging Het
Olfr623 C A 7: 103,660,813 G146C probably damaging Het
Olfr826 A T 10: 130,180,757 I41N possibly damaging Het
Phf14 A T 6: 11,933,341 E67D unknown Het
Prdm16 C T 4: 154,528,637 G111D probably damaging Het
Ptpn23 G A 9: 110,385,257 T1692I unknown Het
Ptprb C T 10: 116,368,766 S1835L probably damaging Het
Rbm19 G A 5: 120,116,467 probably benign Het
Rgs7bp T A 13: 104,982,874 H152L possibly damaging Het
Rmdn3 A T 2: 119,139,368 L404Q probably damaging Het
Rock2 T A 12: 16,973,143 F1148I probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sec24c C A 14: 20,689,333 H559N probably damaging Het
Sephs2 T C 7: 127,273,820 S34G probably benign Het
Serpina6 A T 12: 103,646,944 S366T probably benign Het
Serpinb7 A T 1: 107,450,322 E248D probably benign Het
Sesn1 G T 10: 41,903,728 R386L possibly damaging Het
Skida1 T C 2: 18,046,791 S430G unknown Het
Slc28a2 A T 2: 122,451,981 probably null Het
Slc39a8 T C 3: 135,857,538 F203S possibly damaging Het
Svip A G 7: 52,003,429 S46P possibly damaging Het
Tbx21 T A 11: 97,099,097 D423V probably benign Het
Tcirg1 G A 19: 3,903,576 A117V probably null Het
Tmem63b T A 17: 45,673,168 K258N probably benign Het
Tmem94 A G 11: 115,794,774 N951S probably damaging Het
Uba2 G T 7: 34,141,429 D591E probably benign Het
Unc13b C T 4: 43,258,893 R1356W probably damaging Het
Wasf3 A G 5: 146,466,805 T242A probably benign Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp770 T C 2: 114,197,391 K66E probably damaging Het
Zfyve26 A T 12: 79,268,408 D1431E probably benign Het
Zhx2 G A 15: 57,823,350 R705H probably benign Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166638401 missense probably damaging 1.00
IGL00309:Prex1 APN 2 166609823 missense probably damaging 0.99
IGL00953:Prex1 APN 2 166638409 missense probably damaging 1.00
IGL00961:Prex1 APN 2 166585736 missense probably damaging 0.98
IGL01300:Prex1 APN 2 166638407 missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166569340 splice site probably benign
IGL01753:Prex1 APN 2 166602882 missense probably benign 0.11
IGL01819:Prex1 APN 2 166621245 missense probably damaging 1.00
IGL02058:Prex1 APN 2 166585183 missense probably benign 0.00
IGL02251:Prex1 APN 2 166577886 missense probably damaging 0.99
IGL02326:Prex1 APN 2 166621185 missense probably benign 0.35
IGL02366:Prex1 APN 2 166580427 missense probably damaging 1.00
IGL02414:Prex1 APN 2 166609828 missense probably damaging 1.00
IGL02660:Prex1 APN 2 166593867 missense probably damaging 0.97
IGL02666:Prex1 APN 2 166572989 missense probably benign 0.00
IGL02874:Prex1 APN 2 166585047 missense probably damaging 1.00
IGL02935:Prex1 APN 2 166570345 missense probably damaging 1.00
IGL03179:Prex1 APN 2 166585194 missense probably benign 0.31
R0207:Prex1 UTSW 2 166585898 missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166586699 unclassified probably benign
R0420:Prex1 UTSW 2 166589571 missense probably benign 0.13
R0449:Prex1 UTSW 2 166569377 missense probably benign 0.16
R0458:Prex1 UTSW 2 166585823 missense probably damaging 0.99
R0927:Prex1 UTSW 2 166586537 missense probably benign 0.01
R1299:Prex1 UTSW 2 166585907 missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166593861 missense probably damaging 1.00
R1440:Prex1 UTSW 2 166580463 missense probably damaging 0.98
R1506:Prex1 UTSW 2 166587081 missense probably damaging 1.00
R1725:Prex1 UTSW 2 166601736 missense probably damaging 1.00
R1831:Prex1 UTSW 2 166585101 missense probably damaging 1.00
R1883:Prex1 UTSW 2 166583272 missense probably benign 0.20
R1896:Prex1 UTSW 2 166586654 missense probably benign 0.01
R2022:Prex1 UTSW 2 166575614 missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166569365 missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166587157 missense probably benign 0.00
R2263:Prex1 UTSW 2 166589068 splice site probably benign
R2276:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2279:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2680:Prex1 UTSW 2 166601772 missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166589036 missense probably benign 0.04
R3421:Prex1 UTSW 2 166617854 missense probably damaging 1.00
R3614:Prex1 UTSW 2 166609781 missense probably damaging 1.00
R4244:Prex1 UTSW 2 166570336 missense probably damaging 1.00
R4605:Prex1 UTSW 2 166713544 missense probably benign 0.45
R4685:Prex1 UTSW 2 166638332 missense probably damaging 0.97
R4787:Prex1 UTSW 2 166638340 missense probably benign 0.01
R4796:Prex1 UTSW 2 166592291 missense probably damaging 1.00
R4825:Prex1 UTSW 2 166585857 nonsense probably null
R4955:Prex1 UTSW 2 166573223 missense probably damaging 0.99
R5046:Prex1 UTSW 2 166572963 missense probably benign 0.00
R5095:Prex1 UTSW 2 166581921 missense probably damaging 1.00
R5408:Prex1 UTSW 2 166575653 small insertion probably benign
R5462:Prex1 UTSW 2 166644808 missense probably benign 0.02
R5535:Prex1 UTSW 2 166580273 missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166586659 missense probably damaging 1.00
R5813:Prex1 UTSW 2 166583207 missense probably benign
R5860:Prex1 UTSW 2 166644684 intron probably benign
R5984:Prex1 UTSW 2 166585744 missense probably damaging 1.00
R6009:Prex1 UTSW 2 166581984 missense probably damaging 1.00
R6174:Prex1 UTSW 2 166572963 missense probably benign 0.00
R6345:Prex1 UTSW 2 166572960 missense probably null 0.81
R6897:Prex1 UTSW 2 166581993 missense probably damaging 0.99
R6935:Prex1 UTSW 2 166599655 missense probably damaging 1.00
R7025:Prex1 UTSW 2 166613187 small insertion probably benign
R7037:Prex1 UTSW 2 166587180 missense probably benign 0.05
R7076:Prex1 UTSW 2 166633382 missense probably damaging 0.99
R7361:Prex1 UTSW 2 166713570 missense probably benign 0.04
R7381:Prex1 UTSW 2 166587127 missense probably damaging 1.00
R7721:Prex1 UTSW 2 166577890 nonsense probably null
R7763:Prex1 UTSW 2 166713709 missense unknown
R7809:Prex1 UTSW 2 166573244 missense possibly damaging 0.91
R7998:Prex1 UTSW 2 166587045 critical splice donor site probably null
R8029:Prex1 UTSW 2 166575603 missense probably benign 0.01
R8193:Prex1 UTSW 2 166593860 missense possibly damaging 0.60
X0065:Prex1 UTSW 2 166586625 missense probably benign
Z1176:Prex1 UTSW 2 166572970 nonsense probably null
Z1177:Prex1 UTSW 2 166592228 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCAGGGACAGGTAAGCCAAG -3'
(R):5'- TTAGAAGGATGTCAGTGGCG -3'

Sequencing Primer
(F):5'- CCCAGAGAACATGGGCACTG -3'
(R):5'- CAGTGGAGGTCTCAGGCTG -3'
Posted On2019-06-26