Incidental Mutation 'R7181:Olfr57'
ID558987
Institutional Source Beutler Lab
Gene Symbol Olfr57
Ensembl Gene ENSMUSG00000060205
Gene Nameolfactory receptor 57
SynonymsGA_x6K02T2QGN0-2777431-2776472, IF12, MOR139-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7181 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79028741-79036274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79035453 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 219 (Y219C)
Ref Sequence ENSEMBL: ENSMUSP00000144814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082244] [ENSMUST00000203906]
Predicted Effect probably damaging
Transcript: ENSMUST00000082244
AA Change: Y219C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080872
Gene: ENSMUSG00000060205
AA Change: Y219C

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.2e-49 PFAM
Pfam:7tm_1 42 291 6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203906
AA Change: Y219C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144814
Gene: ENSMUSG00000060205
AA Change: Y219C

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:7tm_4 32 308 2e-49 PFAM
Pfam:7tm_1 42 291 1.9e-23 PFAM
Meta Mutation Damage Score 0.6637 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,881,037 N182D probably benign Het
Adgrl1 A G 8: 83,926,249 probably null Het
Adm T C 7: 110,629,029 I139T probably damaging Het
Ahnak A T 19: 9,013,488 K4045N probably damaging Het
Axin1 T A 17: 26,173,778 S344R probably damaging Het
Cacna1g T C 11: 94,415,865 S1896G probably benign Het
Cd209c A G 8: 3,945,712 V30A probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdh8 A T 8: 99,098,925 M520K probably benign Het
Cyp2b23 G A 7: 26,674,403 T306I probably damaging Het
Dnajc10 T G 2: 80,319,243 Y96* probably null Het
Elmod1 A C 9: 53,934,098 probably null Het
Eva1b A G 4: 126,149,653 H162R possibly damaging Het
Fam222b A T 11: 78,154,978 N455I probably damaging Het
Fer1l6 G A 15: 58,575,297 A626T probably benign Het
Fgd6 A G 10: 94,043,511 T76A probably benign Het
Fndc7 A G 3: 108,881,324 probably null Het
Gabrg2 T A 11: 41,920,434 I295F probably damaging Het
Gm10406 A T 14: 7,027,359 probably null Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm47189 T C 14: 41,770,102 M73V probably benign Het
Gm9758 A T 5: 14,913,653 S54T probably damaging Het
Gm9857 A G 3: 108,940,238 S70P unknown Het
Gsap A T 5: 21,253,429 E470D probably damaging Het
Hesx1 T A 14: 27,000,721 M1K probably null Het
Hirip3 A G 7: 126,864,063 D397G probably damaging Het
Kalrn T A 16: 34,163,077 N13I probably benign Het
Mettl8 A T 2: 70,973,362 S194T possibly damaging Het
Mrps35 T G 6: 147,055,993 probably null Het
Myrfl G T 10: 116,861,543 N25K probably damaging Het
Olfr623 C A 7: 103,660,813 G146C probably damaging Het
Olfr826 A T 10: 130,180,757 I41N possibly damaging Het
Phf14 A T 6: 11,933,341 E67D unknown Het
Prdm16 C T 4: 154,528,637 G111D probably damaging Het
Prex1 G A 2: 166,570,371 A1568V probably damaging Het
Ptpn23 G A 9: 110,385,257 T1692I unknown Het
Ptprb C T 10: 116,368,766 S1835L probably damaging Het
Rbm19 G A 5: 120,116,467 probably benign Het
Rgs7bp T A 13: 104,982,874 H152L possibly damaging Het
Rmdn3 A T 2: 119,139,368 L404Q probably damaging Het
Rock2 T A 12: 16,973,143 F1148I probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sec24c C A 14: 20,689,333 H559N probably damaging Het
Sephs2 T C 7: 127,273,820 S34G probably benign Het
Serpina6 A T 12: 103,646,944 S366T probably benign Het
Serpinb7 A T 1: 107,450,322 E248D probably benign Het
Sesn1 G T 10: 41,903,728 R386L possibly damaging Het
Skida1 T C 2: 18,046,791 S430G unknown Het
Slc28a2 A T 2: 122,451,981 probably null Het
Slc39a8 T C 3: 135,857,538 F203S possibly damaging Het
Svip A G 7: 52,003,429 S46P possibly damaging Het
Tbx21 T A 11: 97,099,097 D423V probably benign Het
Tcirg1 G A 19: 3,903,576 A117V probably null Het
Tmem63b T A 17: 45,673,168 K258N probably benign Het
Tmem94 A G 11: 115,794,774 N951S probably damaging Het
Uba2 G T 7: 34,141,429 D591E probably benign Het
Unc13b C T 4: 43,258,893 R1356W probably damaging Het
Wasf3 A G 5: 146,466,805 T242A probably benign Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp770 T C 2: 114,197,391 K66E probably damaging Het
Zfyve26 A T 12: 79,268,408 D1431E probably benign Het
Zhx2 G A 15: 57,823,350 R705H probably benign Het
Other mutations in Olfr57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Olfr57 APN 10 79035611 missense probably benign 0.05
IGL02230:Olfr57 APN 10 79035042 missense probably damaging 0.99
IGL02283:Olfr57 APN 10 79035545 missense probably damaging 1.00
IGL02878:Olfr57 APN 10 79035558 missense probably benign 0.23
IGL02975:Olfr57 APN 10 79035033 missense possibly damaging 0.83
IGL03259:Olfr57 APN 10 79035400 nonsense probably null
R1366:Olfr57 UTSW 10 79035042 missense probably damaging 1.00
R1438:Olfr57 UTSW 10 79035288 missense possibly damaging 0.88
R1528:Olfr57 UTSW 10 79035564 missense probably damaging 0.96
R1601:Olfr57 UTSW 10 79035504 missense possibly damaging 0.56
R2032:Olfr57 UTSW 10 79035329 missense possibly damaging 0.86
R2112:Olfr57 UTSW 10 79035414 missense probably damaging 1.00
R2382:Olfr57 UTSW 10 79035134 missense possibly damaging 0.52
R2967:Olfr57 UTSW 10 79035053 missense probably damaging 1.00
R3773:Olfr57 UTSW 10 79035180 missense possibly damaging 0.95
R3940:Olfr57 UTSW 10 79035204 missense probably damaging 1.00
R4405:Olfr57 UTSW 10 79035410 missense probably benign
R5944:Olfr57 UTSW 10 79035389 missense probably benign 0.00
R6563:Olfr57 UTSW 10 79035217 missense possibly damaging 0.67
R6614:Olfr57 UTSW 10 79035091 nonsense probably null
R7639:Olfr57 UTSW 10 79035372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACGCTGTGGATTGATGATTC -3'
(R):5'- TCAATGAAGCTGTTGCAGTAGC -3'

Sequencing Primer
(F):5'- GTGTTATAAATTCCCTGTTACACACC -3'
(R):5'- CAGTAGCATGTGAGTTTTGGGTCAC -3'
Posted On2019-06-26