Incidental Mutation 'R0589:Marf1'
ID55899
Institutional Source Beutler Lab
Gene Symbol Marf1
Ensembl Gene ENSMUSG00000060657
Gene Namemeiosis regulator and mRNA stability 1
Synonyms4921513D23Rik
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R0589 (G1)
Quality Score204
Status Validated
Chromosome16
Chromosomal Location14109173-14163351 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 14142055 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090300] [ENSMUST00000229614]
Predicted Effect probably benign
Transcript: ENSMUST00000090300
SMART Domains Protein: ENSMUSP00000087770
Gene: ENSMUSG00000060657

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
Pfam:NYN 351 492 1.5e-21 PFAM
RRM 511 579 3.17e-1 SMART
low complexity region 599 610 N/A INTRINSIC
RRM 790 864 4.47e-3 SMART
internal_repeat_2 871 914 1.57e-5 PROSPERO
low complexity region 944 960 N/A INTRINSIC
Pfam:OST-HTH 1096 1167 1e-11 PFAM
low complexity region 1181 1186 N/A INTRINSIC
Pfam:OST-HTH 1256 1328 1.2e-10 PFAM
Pfam:OST-HTH 1332 1404 2.4e-10 PFAM
Pfam:OST-HTH 1408 1480 6.8e-13 PFAM
Pfam:OST-HTH 1483 1555 3e-14 PFAM
low complexity region 1682 1701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231032
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it may be autoantigenic. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit female infertility with abnormalities in oogenic processes including meiotic progression, genomic integrity and acquisition of developmental competence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,942,268 A1202E probably damaging Het
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Camk2a G A 18: 60,963,964 probably null Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Gpx3 A G 11: 54,909,503 I208V probably benign Het
Grk3 A G 5: 112,928,763 probably benign Het
Heatr9 T C 11: 83,514,690 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr1220 A G 2: 89,097,262 F222L probably benign Het
Olfr531 T G 7: 140,400,900 S49R possibly damaging Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Pgbd1 G A 13: 21,434,430 T19I possibly damaging Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trem1 A G 17: 48,237,217 D90G possibly damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Marf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Marf1 APN 16 14115742 missense possibly damaging 0.49
IGL00933:Marf1 APN 16 14117357 missense probably damaging 1.00
IGL01101:Marf1 APN 16 14146736 missense possibly damaging 0.85
IGL02140:Marf1 APN 16 14141912 missense probably damaging 0.99
IGL03196:Marf1 APN 16 14140259 missense possibly damaging 0.64
PIT4283001:Marf1 UTSW 16 14128568 missense probably benign 0.22
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0056:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0057:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0113:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0115:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0179:Marf1 UTSW 16 14151176 missense probably damaging 1.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0294:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0295:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0316:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0318:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0375:Marf1 UTSW 16 14151320 splice site probably benign
R0383:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0391:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0504:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0603:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0610:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R1240:Marf1 UTSW 16 14146762 missense possibly damaging 0.48
R1445:Marf1 UTSW 16 14115824 missense probably benign
R1716:Marf1 UTSW 16 14142586 missense possibly damaging 0.95
R1921:Marf1 UTSW 16 14128601 missense possibly damaging 0.63
R2098:Marf1 UTSW 16 14114200 missense probably benign 0.00
R2155:Marf1 UTSW 16 14132429 missense probably damaging 0.99
R2177:Marf1 UTSW 16 14152607 missense probably benign 0.01
R2195:Marf1 UTSW 16 14111699 missense probably benign
R2410:Marf1 UTSW 16 14115827 missense probably benign 0.02
R2999:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3000:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3147:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3148:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3430:Marf1 UTSW 16 14140177 unclassified probably benign
R3821:Marf1 UTSW 16 14142554 missense probably damaging 1.00
R4383:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4384:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4520:Marf1 UTSW 16 14132666 missense probably damaging 0.98
R4554:Marf1 UTSW 16 14153977 start gained probably benign
R4557:Marf1 UTSW 16 14153977 start gained probably benign
R4768:Marf1 UTSW 16 14131597 missense possibly damaging 0.93
R4784:Marf1 UTSW 16 14152457 missense probably benign
R4857:Marf1 UTSW 16 14128611 nonsense probably null
R4863:Marf1 UTSW 16 14132665 missense possibly damaging 0.60
R4994:Marf1 UTSW 16 14114231 missense probably benign
R5191:Marf1 UTSW 16 14146078 missense probably damaging 1.00
R5503:Marf1 UTSW 16 14152231 missense probably damaging 0.99
R5813:Marf1 UTSW 16 14152585 missense probably benign 0.35
R5905:Marf1 UTSW 16 14127249 missense probably damaging 0.99
R5960:Marf1 UTSW 16 14152417 missense probably damaging 0.98
R6104:Marf1 UTSW 16 14117455 missense probably damaging 0.99
R6387:Marf1 UTSW 16 14141640 makesense probably null
R6533:Marf1 UTSW 16 14115799 missense probably benign 0.16
R6608:Marf1 UTSW 16 14132714 missense probably damaging 1.00
R6642:Marf1 UTSW 16 14132747 missense probably benign 0.02
R6954:Marf1 UTSW 16 14138520 missense probably damaging 1.00
R6994:Marf1 UTSW 16 14128857 missense probably damaging 1.00
R7010:Marf1 UTSW 16 14137001 missense probably damaging 0.99
R7090:Marf1 UTSW 16 14111702 missense possibly damaging 0.52
R7174:Marf1 UTSW 16 14136953 missense probably damaging 1.00
R7221:Marf1 UTSW 16 14142485 missense probably damaging 1.00
R7247:Marf1 UTSW 16 14127093 missense probably damaging 1.00
R7557:Marf1 UTSW 16 14132696 missense probably damaging 1.00
R7798:Marf1 UTSW 16 14138451 missense probably benign 0.00
R7807:Marf1 UTSW 16 14153889 nonsense probably null
R7855:Marf1 UTSW 16 14114201 missense probably benign 0.27
R7867:Marf1 UTSW 16 14128606 missense probably damaging 0.97
R7893:Marf1 UTSW 16 14146735 missense probably damaging 1.00
R7938:Marf1 UTSW 16 14114201 missense probably benign 0.27
R7950:Marf1 UTSW 16 14128606 missense probably damaging 0.97
R7976:Marf1 UTSW 16 14146735 missense probably damaging 1.00
U24488:Marf1 UTSW 16 14132366 nonsense probably null
X0025:Marf1 UTSW 16 14114278 missense probably damaging 1.00
Z1176:Marf1 UTSW 16 14115777 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTAAAGTGGCTCTGTCACACCTG -3'
(R):5'- TTGCCGACAAAGTGAAGTCTCCC -3'

Sequencing Primer
(F):5'- ACACCTGTGTTCTTCACGATGG -3'
(R):5'- CAGGCAAATTCTGGATCTGC -3'
Posted On2013-07-11