Mutagenetix > Incidental Mutations

Incidental Mutation 'R7182:Col6a3'

559018

Institutional Source

Beutler Lab

Gene Symbol

Col6a3

Ensembl Gene

ENSMUSG00000048126

Gene Name

collagen, type VI, alpha 3

Synonyms

Col6a-3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7182 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90765923-90843971 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 90803678 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1618 (Q1618*)

Ref Sequence

ENSEMBL: ENSMUSP00000115210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]

Predicted Effect

probably null
Transcript: ENSMUST00000056925
AA Change: Q1618*

SMART Domains

Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: Q1618*

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
VWA	1634	1807	1.78e-37	SMART
VWA	1833	2022	7.92e-3	SMART
Pfam:Collagen	2033	2094	2e-10	PFAM
Pfam:Collagen	2077	2142	2.8e-10	PFAM
low complexity region	2179	2222	N/A	INTRINSIC
low complexity region	2228	2279	N/A	INTRINSIC
Pfam:Collagen	2311	2373	7.9e-11	PFAM
VWA	2397	2576	3.95e-21	SMART
VWA	2614	2813	2.25e-25	SMART
low complexity region	2864	2880	N/A	INTRINSIC
low complexity region	2886	2900	N/A	INTRINSIC
low complexity region	2903	2941	N/A	INTRINSIC
low complexity region	2945	3024	N/A	INTRINSIC
low complexity region	3039	3076	N/A	INTRINSIC
low complexity region	3091	3103	N/A	INTRINSIC
FN3	3104	3183	4.6e-1	SMART
KU	3226	3279	4.34e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000097653
AA Change: Q1011*

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: Q1011*

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000130846
AA Change: Q1618*

SMART Domains

Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: Q1618*

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
Pfam:VWA	1636	1703	1.4e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000188587
AA Change: Q1011*

SMART Domains

Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: Q1011*

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	35	210	4.7e-45	SMART
VWA	227	403	2.7e-41	SMART
VWA	417	596	2e-42	SMART
VWA	621	799	7e-45	SMART
VWA	824	997	5.8e-42	SMART
VWA	1027	1200	1.1e-39	SMART
VWA	1226	1415	4.8e-5	SMART
Pfam:Collagen	1426	1486	3.8e-8	PFAM
Pfam:Collagen	1473	1539	9.1e-8	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	2.4e-23	SMART
VWA	2007	2206	1.4e-27	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	2.2e-3	SMART
KU	2619	2672	2.1e-26	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,849,714	V323A	unknown	Het
AC117241.1	A	G	17: 7,352,688	V158A	unknown	Het
Acadm	A	G	3: 153,941,881		probably null	Het
Adcy10	T	G	1: 165,543,470		probably null	Het
Aldh6a1	C	T	12: 84,441,831	A94T	probably benign	Het
Ano2	T	A	6: 125,790,293	L229Q	probably damaging	Het
Cacna1h	C	T	17: 25,377,655	R1828H	probably damaging	Het
Ccdc33	A	T	9: 58,034,173		probably null	Het
Cep112	A	C	11: 108,682,844	D6A	probably benign	Het
Chd9	T	C	8: 91,006,622	F1373S	unknown	Het
Cog5	T	C	12: 31,685,708	L158P	probably damaging	Het
Dlg5	A	G	14: 24,244,856	V3A		Het
Dnah7a	T	A	1: 53,620,461		probably null	Het
Dpp10	A	T	1: 123,341,151	H716Q	probably benign	Het
Epor	A	G	9: 21,963,329	F35L	probably benign	Het
Ergic1	A	T	17: 26,654,882	Y92F		Het
Fam71a	C	T	1: 191,163,351	R365H	probably damaging	Het
Fam98a	G	A	17: 75,539,018	Q273*	probably null	Het
Fhdc1	G	A	3: 84,448,850	T429I	probably damaging	Het
Fmnl2	T	A	2: 53,107,441	L468Q	unknown	Het
Fmnl3	C	T	15: 99,321,782	R695Q	probably damaging	Het
Gabrg2	T	C	11: 41,920,506	M271V	probably damaging	Het
Gk5	G	T	9: 96,119,526	V26L	possibly damaging	Het
Gm14412	A	C	2: 177,315,615	N162K	probably benign	Het
Gm3604	T	C	13: 62,371,875	D22G	probably damaging	Het
Gm5565	G	T	5: 146,158,055	H294N	probably benign	Het
Hsf2	T	A	10: 57,505,176	D287E	possibly damaging	Het
Impdh2	G	A	9: 108,563,208	R231H	possibly damaging	Het
Irak3	T	C	10: 120,166,511	H234R	probably damaging	Het
Lrba	GTTCCCTTC	GTTC	3: 86,741,458		probably null	Het
Lrch3	T	A	16: 32,993,779	D551E	probably benign	Het
Manba	A	T	3: 135,567,513	N736I	probably benign	Het
Map2	A	G	1: 66,412,653	D234G	possibly damaging	Het
Mdk	C	A	2: 91,930,852	K121N	unknown	Het
Mfn1	T	A	3: 32,564,220	L526Q	probably damaging	Het
Mfsd2b	A	G	12: 4,866,157		probably null	Het
Mnat1	G	T	12: 73,230,678	E233*	probably null	Het
Mtmr4	T	C	11: 87,604,605		probably null	Het
Mtrf1	A	G	14: 79,423,464	E432G	possibly damaging	Het
Muc5b	C	T	7: 141,842,645	R165C	unknown	Het
Naip6	T	A	13: 100,316,149	I135F	probably benign	Het
Nod2	A	G	8: 88,663,832	T256A	probably benign	Het
Notch4	T	A	17: 34,583,499	V1298E	probably damaging	Het
Nudc	G	T	4: 133,534,465	D169E	possibly damaging	Het
Obscn	A	T	11: 59,035,101	I5602N	probably damaging	Het
Olfr1468-ps1	G	A	19: 13,375,844	G294E	unknown	Het
Osbpl10	G	A	9: 115,067,251	D18N	probably damaging	Het
Pigk	G	A	3: 152,722,551	V72I	possibly damaging	Het
Prl8a6	C	T	13: 27,437,170	E26K	probably damaging	Het
Prpf8	A	G	11: 75,490,727	Y318C	possibly damaging	Het
Rab13	A	G	3: 90,224,763	D159G	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Ryr2	T	C	13: 11,759,757	H1171R	probably benign	Het
Scn4a	T	A	11: 106,330,308	I842F	probably benign	Het
Scnm1	A	T	3: 95,133,854	N14K	possibly damaging	Het
Serinc1	A	T	10: 57,524,361	I137N	probably benign	Het
Slc30a3	T	C	5: 31,086,825	Q371R	probably benign	Het
Slc30a3	A	C	5: 31,089,670	M103R	probably damaging	Het
Slco1a1	A	T	6: 141,911,839	C589S	probably damaging	Het
Slco1b2	A	G	6: 141,656,930	Y203C	probably damaging	Het
Spty2d1	A	T	7: 46,998,523	D219E	probably benign	Het
Svep1	A	T	4: 58,043,991	S3552T	probably benign	Het
Tmem62	A	G	2: 121,004,743	I516M	probably benign	Het
Trim61	A	T	8: 65,013,614	S332T	probably damaging	Het
Trmt10b	A	C	4: 45,308,520	T227P	probably benign	Het
Trpc3	T	C	3: 36,655,109	Q406R	probably benign	Het
Ttc30b	A	T	2: 75,937,949	Y153*	probably null	Het
Ush2a	A	T	1: 188,753,543	Y2950F	probably benign	Het
Usp32	C	T	11: 85,040,170	G478D	probably benign	Het
Wdfy3	A	G	5: 101,943,892	L527P	possibly damaging	Het
Wdr73	A	G	7: 80,893,678	V163A	possibly damaging	Het

Other mutations in Col6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Col6a3	APN	1	90828255	missense	probably damaging	1.00
IGL00425:Col6a3	APN	1	90782026	missense	unknown
IGL00541:Col6a3	APN	1	90802142	missense	possibly damaging	0.83
IGL01063:Col6a3	APN	1	90802332	missense	probably damaging	1.00
IGL01094:Col6a3	APN	1	90803933	missense	possibly damaging	0.93
IGL01138:Col6a3	APN	1	90807510	missense	probably damaging	1.00
IGL01291:Col6a3	APN	1	90802292	missense	probably damaging	1.00
IGL01674:Col6a3	APN	1	90802514	missense	probably damaging	1.00
IGL01756:Col6a3	APN	1	90779162	missense	unknown
IGL01827:Col6a3	APN	1	90802319	missense	probably damaging	1.00
IGL01845:Col6a3	APN	1	90796571	missense	probably damaging	1.00
IGL01869:Col6a3	APN	1	90773048	missense	unknown
IGL01900:Col6a3	APN	1	90795010	critical splice donor site	probably null
IGL01925:Col6a3	APN	1	90802236	missense	possibly damaging	0.95
IGL02002:Col6a3	APN	1	90782136	splice site	probably benign
IGL02115:Col6a3	APN	1	90807651	missense	probably damaging	0.99
IGL02302:Col6a3	APN	1	90781760	missense	unknown
IGL02313:Col6a3	APN	1	90811606	missense	probably damaging	1.00
IGL02458:Col6a3	APN	1	90779197	missense	unknown
IGL02821:Col6a3	APN	1	90803878	missense	probably damaging	1.00
IGL02828:Col6a3	APN	1	90796559	missense	probably damaging	1.00
IGL03112:Col6a3	APN	1	90811520	nonsense	probably null
IGL03129:Col6a3	APN	1	90821862	missense	probably damaging	1.00
IGL03132:Col6a3	APN	1	90803893	missense	probably damaging	1.00
IGL03148:Col6a3	APN	1	90827866	missense	probably benign	0.33
IGL03251:Col6a3	APN	1	90810176	missense	probably damaging	1.00
Noodloid	UTSW	1	90779289	missense	unknown
stringy	UTSW	1	90803678	nonsense	probably null
ANU05:Col6a3	UTSW	1	90802292	missense	probably damaging	1.00
IGL03048:Col6a3	UTSW	1	90810248	missense	possibly damaging	0.58
PIT4810001:Col6a3	UTSW	1	90778794	missense	unknown
R0020:Col6a3	UTSW	1	90811550	missense	probably damaging	0.99
R0020:Col6a3	UTSW	1	90811550	missense	probably damaging	0.99
R0033:Col6a3	UTSW	1	90802245	missense	probably damaging	1.00
R0033:Col6a3	UTSW	1	90802245	missense	probably damaging	1.00
R0105:Col6a3	UTSW	1	90798161	missense	possibly damaging	0.65
R0116:Col6a3	UTSW	1	90813551	missense	probably damaging	1.00
R0167:Col6a3	UTSW	1	90798173	missense	probably damaging	1.00
R0319:Col6a3	UTSW	1	90807704	missense	possibly damaging	0.95
R0348:Col6a3	UTSW	1	90828049	missense	probably damaging	1.00
R0365:Col6a3	UTSW	1	90788216	missense	unknown
R0512:Col6a3	UTSW	1	90821798	intron	probably benign
R0564:Col6a3	UTSW	1	90807734	missense	probably damaging	1.00
R0635:Col6a3	UTSW	1	90808086	splice site	probably null
R0667:Col6a3	UTSW	1	90828101	missense	probably damaging	0.98
R0680:Col6a3	UTSW	1	90778981	missense	unknown
R0736:Col6a3	UTSW	1	90804089	missense	possibly damaging	0.95
R0737:Col6a3	UTSW	1	90828298	missense	probably damaging	1.00
R0747:Col6a3	UTSW	1	90802653	missense	probably damaging	1.00
R1155:Col6a3	UTSW	1	90794325	missense	probably null	1.00
R1169:Col6a3	UTSW	1	90822014	missense	possibly damaging	0.67
R1180:Col6a3	UTSW	1	90781855	missense	unknown
R1225:Col6a3	UTSW	1	90811516	missense	probably damaging	1.00
R1343:Col6a3	UTSW	1	90768347	missense	unknown
R1387:Col6a3	UTSW	1	90822416	intron	probably benign
R1437:Col6a3	UTSW	1	90801376	missense	probably damaging	1.00
R1448:Col6a3	UTSW	1	90781855	missense	unknown
R1677:Col6a3	UTSW	1	90821861	missense	probably benign	0.14
R1681:Col6a3	UTSW	1	90773502	missense	unknown
R1711:Col6a3	UTSW	1	90830213	missense	probably damaging	1.00
R1727:Col6a3	UTSW	1	90796574	critical splice acceptor site	probably null
R1736:Col6a3	UTSW	1	90779059	missense	unknown
R1738:Col6a3	UTSW	1	90816361	missense	probably damaging	1.00
R1742:Col6a3	UTSW	1	90813794	missense	probably damaging	1.00
R1809:Col6a3	UTSW	1	90827949	missense	probably damaging	1.00
R1851:Col6a3	UTSW	1	90807534	missense	possibly damaging	0.69
R1852:Col6a3	UTSW	1	90807534	missense	possibly damaging	0.69
R1872:Col6a3	UTSW	1	90830214	missense	probably damaging	0.96
R1889:Col6a3	UTSW	1	90803711	missense	probably benign	0.00
R1895:Col6a3	UTSW	1	90803711	missense	probably benign	0.00
R1908:Col6a3	UTSW	1	90811699	missense	probably damaging	1.00
R1919:Col6a3	UTSW	1	90822359	missense	possibly damaging	0.66
R1973:Col6a3	UTSW	1	90804175	missense	probably damaging	1.00
R2083:Col6a3	UTSW	1	90782011	missense	unknown
R2121:Col6a3	UTSW	1	90810365	missense	probably damaging	1.00
R2197:Col6a3	UTSW	1	90803745	missense	probably benign	0.09
R2448:Col6a3	UTSW	1	90813358	missense	probably damaging	1.00
R2831:Col6a3	UTSW	1	90803713	missense	possibly damaging	0.89
R2877:Col6a3	UTSW	1	90775599	missense	unknown
R3052:Col6a3	UTSW	1	90802130	missense	possibly damaging	0.71
R3104:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3105:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3106:Col6a3	UTSW	1	90816302	missense	probably damaging	0.99
R3418:Col6a3	UTSW	1	90804091	missense	probably benign	0.42
R3419:Col6a3	UTSW	1	90804091	missense	probably benign	0.42
R3837:Col6a3	UTSW	1	90780081	missense	unknown
R4007:Col6a3	UTSW	1	90802569	missense	probably damaging	1.00
R4082:Col6a3	UTSW	1	90821883	missense	probably damaging	1.00
R4181:Col6a3	UTSW	1	90807614	missense	probably damaging	1.00
R4200:Col6a3	UTSW	1	90801383	missense	probably benign	0.28
R4244:Col6a3	UTSW	1	90786639	missense	unknown
R4297:Col6a3	UTSW	1	90811378	missense	probably damaging	1.00
R4302:Col6a3	UTSW	1	90807614	missense	probably damaging	1.00
R4472:Col6a3	UTSW	1	90822014	missense	probably benign	0.23
R4600:Col6a3	UTSW	1	90781904	missense	unknown
R4683:Col6a3	UTSW	1	90773457	missense	unknown
R4788:Col6a3	UTSW	1	90772950	critical splice donor site	probably null
R4851:Col6a3	UTSW	1	90779289	missense	unknown
R4899:Col6a3	UTSW	1	90802427	missense	probably damaging	0.99
R4904:Col6a3	UTSW	1	90801442	missense	probably damaging	1.00
R4908:Col6a3	UTSW	1	90807524	missense	probably damaging	1.00
R4960:Col6a3	UTSW	1	90804218	missense	probably damaging	1.00
R4981:Col6a3	UTSW	1	90778843	missense	unknown
R5057:Col6a3	UTSW	1	90816130	missense	possibly damaging	0.91
R5062:Col6a3	UTSW	1	90779352	missense	unknown
R5105:Col6a3	UTSW	1	90798140	missense	possibly damaging	0.81
R5127:Col6a3	UTSW	1	90768345	missense	unknown
R5166:Col6a3	UTSW	1	90810608	missense	probably damaging	1.00
R5168:Col6a3	UTSW	1	90773639	nonsense	probably null
R5196:Col6a3	UTSW	1	90816538	splice site	probably null
R5230:Col6a3	UTSW	1	90789054	missense	unknown
R5268:Col6a3	UTSW	1	90785243	missense	unknown
R5381:Col6a3	UTSW	1	90775612	missense	unknown
R5392:Col6a3	UTSW	1	90801295	missense	probably benign	0.41
R5445:Col6a3	UTSW	1	90782039	nonsense	probably null
R5571:Col6a3	UTSW	1	90788216	missense	unknown
R5665:Col6a3	UTSW	1	90827880	missense	probably benign	0.00
R5902:Col6a3	UTSW	1	90802199	splice site	probably null
R5914:Col6a3	UTSW	1	90776200	missense	unknown
R5955:Col6a3	UTSW	1	90811441	missense	probably damaging	1.00
R5977:Col6a3	UTSW	1	90821849	missense	possibly damaging	0.82
R6006:Col6a3	UTSW	1	90768383	missense	unknown
R6010:Col6a3	UTSW	1	90773497	missense	unknown
R6025:Col6a3	UTSW	1	90828102	missense	probably damaging	1.00
R6151:Col6a3	UTSW	1	90813753	missense	possibly damaging	0.53
R6154:Col6a3	UTSW	1	90773665	missense	unknown
R6181:Col6a3	UTSW	1	90816374	missense	possibly damaging	0.95
R6197:Col6a3	UTSW	1	90822341	missense	probably damaging	1.00
R6332:Col6a3	UTSW	1	90822233	missense	probably damaging	1.00
R6362:Col6a3	UTSW	1	90810563	missense	probably damaging	0.99
R6476:Col6a3	UTSW	1	90781812	missense	unknown
R6484:Col6a3	UTSW	1	90791923	critical splice donor site	probably null
R6701:Col6a3	UTSW	1	90792462	missense	probably benign	0.14
R6702:Col6a3	UTSW	1	90779439	missense	unknown
R6703:Col6a3	UTSW	1	90779439	missense	unknown
R6703:Col6a3	UTSW	1	90792462	missense	probably benign	0.14
R6724:Col6a3	UTSW	1	90779152	missense	unknown
R6746:Col6a3	UTSW	1	90779045	missense	unknown
R6797:Col6a3	UTSW	1	90804088	missense	probably damaging	0.99
R6798:Col6a3	UTSW	1	90795009	splice site	probably null
R6903:Col6a3	UTSW	1	90794207	missense	probably damaging	1.00
R6925:Col6a3	UTSW	1	90816002	missense	probably benign	0.00
R6978:Col6a3	UTSW	1	90807470	critical splice donor site	probably null
R7058:Col6a3	UTSW	1	90828037	nonsense	probably null
R7294:Col6a3	UTSW	1	90828283	missense	probably damaging	1.00
R7296:Col6a3	UTSW	1	90827986	missense	probably benign	0.00
R7311:Col6a3	UTSW	1	90822291	missense	probably damaging	1.00
R7412:Col6a3	UTSW	1	90828133	missense	probably damaging	0.98
R7561:Col6a3	UTSW	1	90775741	missense	unknown
R7575:Col6a3	UTSW	1	90810599	missense	possibly damaging	0.92
R7659:Col6a3	UTSW	1	90781745	missense	unknown
R7679:Col6a3	UTSW	1	90811751	missense	possibly damaging	0.49
R7831:Col6a3	UTSW	1	90796546	nonsense	probably null
R7855:Col6a3	UTSW	1	90810621	missense	possibly damaging	0.57
R7990:Col6a3	UTSW	1	90781855	missense	unknown
R8003:Col6a3	UTSW	1	90775733	missense	unknown
R8007:Col6a3	UTSW	1	90777457	missense	unknown
R8098:Col6a3	UTSW	1	90803661	missense	probably benign
R8312:Col6a3	UTSW	1	90813690	missense	possibly damaging	0.55
R8419:Col6a3	UTSW	1	90802213	missense	probably damaging	1.00
R8723:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8725:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8737:Col6a3	UTSW	1	90800025	missense	probably benign	0.10
R8742:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8743:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8744:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8753:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8754:Col6a3	UTSW	1	90767606	critical splice acceptor site	probably benign
R8773:Col6a3	UTSW	1	90768449	missense	unknown
RF005:Col6a3	UTSW	1	90811262	missense	probably benign	0.00
RF012:Col6a3	UTSW	1	90810560	missense	probably damaging	1.00
X0024:Col6a3	UTSW	1	90803637	critical splice donor site	probably null
X0063:Col6a3	UTSW	1	90803905	missense	probably damaging	1.00
X0067:Col6a3	UTSW	1	90811529	missense	probably damaging	1.00
Z1177:Col6a3	UTSW	1	90811728	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TGATGACCTTACACGTTGGG -3'
(R):5'- ATAAGCTCATCGGGGATTGTG -3'

Sequencing Primer
(F):5'- ACCTTACACGTTGGGGGACATG -3'
(R):5'- TTGTGAGCTTAGGAATAGGAGATC -3'

Posted On

2019-06-26