Incidental Mutation 'R7182:Fmnl2'
ID 559022
Institutional Source Beutler Lab
Gene Symbol Fmnl2
Ensembl Gene ENSMUSG00000036053
Gene Name formin-like 2
Synonyms 5430425K04Rik, man
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 52857860-53133804 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53107441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 468 (L468Q)
Ref Sequence ENSEMBL: ENSMUSP00000117822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049483] [ENSMUST00000050719] [ENSMUST00000090952] [ENSMUST00000127122] [ENSMUST00000155586]
AlphaFold A2APV2
Predicted Effect probably damaging
Transcript: ENSMUST00000049483
AA Change: L468Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047260
Gene: ENSMUSG00000036053
AA Change: L468Q

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 8e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000050719
AA Change: L468Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057084
Gene: ENSMUSG00000036053
AA Change: L468Q

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
FH2 581 1018 1.66e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090952
AA Change: L468Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088472
Gene: ENSMUSG00000036053
AA Change: L468Q

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 6e-3 SMART
FH2 615 1052 1.66e-124 SMART
low complexity region 1063 1075 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127122
AA Change: L468Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118658
Gene: ENSMUSG00000036053
AA Change: L468Q

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 7e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect unknown
Transcript: ENSMUST00000155586
AA Change: L468Q
SMART Domains Protein: ENSMUSP00000117822
Gene: ENSMUSG00000036053
AA Change: L468Q

DomainStartEndE-ValueType
Pfam:FH2 1 131 2e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Fmnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fmnl2 APN 2 53114917 missense probably damaging 1.00
IGL00960:Fmnl2 APN 2 53123482 missense probably damaging 0.98
IGL01343:Fmnl2 APN 2 53123545 missense probably damaging 1.00
IGL01790:Fmnl2 APN 2 53118368 missense probably damaging 1.00
IGL02555:Fmnl2 APN 2 53126851 critical splice acceptor site probably null
IGL02613:Fmnl2 APN 2 53073735 critical splice donor site probably null
IGL02712:Fmnl2 APN 2 53036498 splice site probably benign
IGL02715:Fmnl2 APN 2 53072210 missense possibly damaging 0.93
IGL02750:Fmnl2 APN 2 53103697 missense possibly damaging 0.95
IGL02832:Fmnl2 APN 2 52858249 missense possibly damaging 0.90
IGL02975:Fmnl2 APN 2 53101482 missense probably benign 0.45
Beefeater UTSW 2 53073654 missense unknown
waterloo UTSW 2 53014848 missense probably damaging 1.00
PIT4280001:Fmnl2 UTSW 2 53118196 missense unknown
R0529:Fmnl2 UTSW 2 53042365 missense probably damaging 1.00
R0571:Fmnl2 UTSW 2 53054491 missense probably benign 0.01
R0707:Fmnl2 UTSW 2 53054486 missense possibly damaging 0.85
R1172:Fmnl2 UTSW 2 53072274 missense probably damaging 1.00
R1473:Fmnl2 UTSW 2 52858207 missense possibly damaging 0.53
R1533:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1536:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1537:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1547:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1548:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1549:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1604:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1608:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1615:Fmnl2 UTSW 2 53118424 missense probably damaging 1.00
R1792:Fmnl2 UTSW 2 53042317 missense possibly damaging 0.79
R1965:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R1970:Fmnl2 UTSW 2 53105576 missense possibly damaging 0.93
R2012:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2065:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2111:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2112:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2427:Fmnl2 UTSW 2 53116979 missense probably damaging 0.96
R4084:Fmnl2 UTSW 2 53107495 missense possibly damaging 0.96
R4095:Fmnl2 UTSW 2 53101523 missense probably damaging 0.99
R4607:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4608:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4720:Fmnl2 UTSW 2 53107540 missense possibly damaging 0.96
R4731:Fmnl2 UTSW 2 53117069 missense possibly damaging 0.95
R4947:Fmnl2 UTSW 2 53073710 missense probably benign 0.32
R5015:Fmnl2 UTSW 2 53103761 missense possibly damaging 0.85
R5402:Fmnl2 UTSW 2 53128782 missense probably damaging 0.97
R5731:Fmnl2 UTSW 2 53118137 splice site probably null
R5766:Fmnl2 UTSW 2 53101454 missense probably damaging 1.00
R5945:Fmnl2 UTSW 2 53114199 missense probably damaging 0.99
R6093:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R6210:Fmnl2 UTSW 2 53130445 missense possibly damaging 0.94
R6287:Fmnl2 UTSW 2 53014848 missense probably damaging 1.00
R6661:Fmnl2 UTSW 2 53108285 missense probably damaging 0.98
R6967:Fmnl2 UTSW 2 53097332 missense possibly damaging 0.88
R7006:Fmnl2 UTSW 2 53108254 missense probably benign 0.27
R7146:Fmnl2 UTSW 2 53068540 missense
R7173:Fmnl2 UTSW 2 53114190 missense unknown
R7176:Fmnl2 UTSW 2 53114150 missense unknown
R7201:Fmnl2 UTSW 2 53073654 missense unknown
R7470:Fmnl2 UTSW 2 53042365 missense probably damaging 1.00
R7481:Fmnl2 UTSW 2 53108431 missense unknown
R7691:Fmnl2 UTSW 2 53101498 missense unknown
R7699:Fmnl2 UTSW 2 53036508 missense
R7700:Fmnl2 UTSW 2 53036508 missense
R7722:Fmnl2 UTSW 2 53054467 missense
R7775:Fmnl2 UTSW 2 53073680 missense unknown
R7824:Fmnl2 UTSW 2 53073680 missense unknown
R8282:Fmnl2 UTSW 2 53107666 critical splice donor site probably null
R8774:Fmnl2 UTSW 2 53042309 missense
R8774-TAIL:Fmnl2 UTSW 2 53042309 missense
R8816:Fmnl2 UTSW 2 53114202 missense unknown
R8832:Fmnl2 UTSW 2 53054572 missense
R8868:Fmnl2 UTSW 2 53126065 missense unknown
R8990:Fmnl2 UTSW 2 53126959 missense unknown
R9412:Fmnl2 UTSW 2 53117004 missense unknown
R9502:Fmnl2 UTSW 2 53108300 missense unknown
R9532:Fmnl2 UTSW 2 53116929 missense unknown
R9602:Fmnl2 UTSW 2 53123575 critical splice donor site probably null
R9760:Fmnl2 UTSW 2 53054515 missense
Z1188:Fmnl2 UTSW 2 53114871 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTCCCGAATGTCTGAGTGCG -3'
(R):5'- GGGCATCTTACCTGCTTCAG -3'

Sequencing Primer
(F):5'- GAGTGCGGGTTCTCTCTCCAC -3'
(R):5'- GGCATCTTACCTGCTTCAGATGTG -3'
Posted On 2019-06-26