Incidental Mutation 'R7182:Tmem62'
ID 559025
Institutional Source Beutler Lab
Gene Symbol Tmem62
Ensembl Gene ENSMUSG00000054484
Gene Name transmembrane protein 62
Synonyms B830009D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120977017-121007852 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121004743 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 516 (I516M)
Ref Sequence ENSEMBL: ENSMUSP00000064310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060455] [ENSMUST00000067582] [ENSMUST00000099488] [ENSMUST00000099489] [ENSMUST00000110686] [ENSMUST00000139428] [ENSMUST00000171260]
AlphaFold Q8BXJ9
Predicted Effect probably benign
Transcript: ENSMUST00000060455
SMART Domains Protein: ENSMUSP00000062496
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 50 318 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067582
AA Change: I516M

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064310
Gene: ENSMUSG00000054484
AA Change: I516M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Metallophos 56 261 7.3e-11 PFAM
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 479 501 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099488
SMART Domains Protein: ENSMUSP00000097087
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 50 311 4.8e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099489
SMART Domains Protein: ENSMUSP00000097088
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 3 271 3.7e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110686
AA Change: I386M

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106314
Gene: ENSMUSG00000054484
AA Change: I386M

DomainStartEndE-ValueType
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139428
SMART Domains Protein: ENSMUSP00000118808
Gene: ENSMUSG00000054484

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
SCOP:d1utea_ 59 274 9e-9 SMART
low complexity region 308 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171260
SMART Domains Protein: ENSMUSP00000125961
Gene: ENSMUSG00000023572

DomainStartEndE-ValueType
Pfam:GCIP 52 309 4.7e-74 PFAM
Meta Mutation Damage Score 0.1101 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Tmem62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tmem62 APN 2 121006964 splice site probably null
IGL01011:Tmem62 APN 2 120979219 missense possibly damaging 0.48
IGL02125:Tmem62 APN 2 120996512 missense probably benign 0.01
IGL02430:Tmem62 APN 2 120986662 missense probably damaging 1.00
R0031:Tmem62 UTSW 2 120999113 missense probably benign 0.00
R0535:Tmem62 UTSW 2 121002596 missense possibly damaging 0.88
R1597:Tmem62 UTSW 2 120984362 missense probably benign 0.01
R1656:Tmem62 UTSW 2 121007002 missense probably benign 0.36
R1682:Tmem62 UTSW 2 121007057 missense probably benign 0.32
R1702:Tmem62 UTSW 2 120979227 missense probably damaging 1.00
R1755:Tmem62 UTSW 2 120984477 critical splice donor site probably null
R1886:Tmem62 UTSW 2 120986670 missense probably damaging 0.99
R1943:Tmem62 UTSW 2 120986626 missense probably benign 0.10
R2151:Tmem62 UTSW 2 120986862 missense probably damaging 1.00
R2419:Tmem62 UTSW 2 121007105 missense probably damaging 0.98
R3034:Tmem62 UTSW 2 120979124 splice site probably benign
R3782:Tmem62 UTSW 2 120977467 missense probably damaging 1.00
R4326:Tmem62 UTSW 2 120980510 missense probably damaging 1.00
R4328:Tmem62 UTSW 2 120980510 missense probably damaging 1.00
R4620:Tmem62 UTSW 2 120996364 intron probably benign
R5168:Tmem62 UTSW 2 120993607 missense probably benign 0.16
R5625:Tmem62 UTSW 2 120990393 missense probably damaging 1.00
R6057:Tmem62 UTSW 2 120977462 missense probably damaging 0.98
R6386:Tmem62 UTSW 2 120999114 missense probably benign 0.00
R7038:Tmem62 UTSW 2 120993577 missense possibly damaging 0.87
R7569:Tmem62 UTSW 2 121006930 missense probably benign
R7607:Tmem62 UTSW 2 120996440 missense probably benign 0.00
R7849:Tmem62 UTSW 2 120984372 missense probably benign 0.01
R8353:Tmem62 UTSW 2 120984336 missense probably damaging 0.99
R8531:Tmem62 UTSW 2 121007052 missense probably damaging 0.99
R8944:Tmem62 UTSW 2 120986835 critical splice acceptor site probably null
R9218:Tmem62 UTSW 2 121004743 missense probably benign 0.08
R9448:Tmem62 UTSW 2 120977730 missense probably damaging 1.00
R9597:Tmem62 UTSW 2 120999086 missense probably benign 0.23
X0052:Tmem62 UTSW 2 120993528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCTCTTGCTTATTCCCATAAAG -3'
(R):5'- ACCATGGGCTATTAGACACTGC -3'

Sequencing Primer
(F):5'- GGACAATCTGCAAGAGTCAGTTCTC -3'
(R):5'- CACTGCTGTGCAAGTAAGTAGG -3'
Posted On 2019-06-26