Incidental Mutation 'R7182:Mfn1'
ID 559026
Institutional Source Beutler Lab
Gene Symbol Mfn1
Ensembl Gene ENSMUSG00000027668
Gene Name mitofusin 1
Synonyms 6330416C07Rik, HR2, D3Ertd265e, 2310002F04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 32529465-32579239 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32564220 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 526 (L526Q)
Ref Sequence ENSEMBL: ENSMUSP00000088801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091257] [ENSMUST00000118286] [ENSMUST00000151320]
AlphaFold Q811U4
PDB Structure Mitofusin domain HR2 V686M/I708M mutant [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000091257
AA Change: L526Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088801
Gene: ENSMUSG00000027668
AA Change: L526Q

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 1.7e-6 PFAM
Pfam:Dynamin_N 78 238 3.9e-24 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Pfam:Fzo_mitofusin 575 735 1.2e-78 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118286
AA Change: L526Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113251
Gene: ENSMUSG00000027668
AA Change: L526Q

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 1.2e-6 PFAM
Pfam:Dynamin_N 78 238 5e-24 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Pfam:Fzo_mitofusin 567 737 6.3e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151320
AA Change: L174Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120960
Gene: ENSMUSG00000027668
AA Change: L174Q

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Pfam:Fzo_mitofusin 215 319 1.2e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mediator of mitochondrial fusion. This protein and mitofusin 2 are homologs of the Drosophila protein fuzzy onion (Fzo). They are mitochondrial membrane proteins that interact with each other to facilitate mitochondrial targeting. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die in mid gestation. Structural and functional abnormalities of mitochondria are reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Mfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Mfn1 APN 3 32542836 missense probably damaging 1.00
IGL01687:Mfn1 APN 3 32563366 splice site probably benign
IGL02743:Mfn1 APN 3 32574290 missense probably benign 0.10
PIT4520001:Mfn1 UTSW 3 32561546 missense probably benign
R0039:Mfn1 UTSW 3 32538267 splice site probably benign
R0571:Mfn1 UTSW 3 32561472 missense probably damaging 1.00
R0920:Mfn1 UTSW 3 32534236 critical splice acceptor site probably null
R1661:Mfn1 UTSW 3 32534322 missense probably benign 0.00
R1665:Mfn1 UTSW 3 32534322 missense probably benign 0.00
R2153:Mfn1 UTSW 3 32542826 missense probably damaging 1.00
R2156:Mfn1 UTSW 3 32534251 missense possibly damaging 0.60
R2260:Mfn1 UTSW 3 32563426 nonsense probably null
R2420:Mfn1 UTSW 3 32569515 missense probably benign 0.21
R3864:Mfn1 UTSW 3 32563092 missense possibly damaging 0.89
R4079:Mfn1 UTSW 3 32542849 missense probably damaging 1.00
R4162:Mfn1 UTSW 3 32562998 splice site probably benign
R4897:Mfn1 UTSW 3 32546562 intron probably benign
R5115:Mfn1 UTSW 3 32564307 critical splice donor site probably null
R5276:Mfn1 UTSW 3 32564205 missense probably benign 0.39
R5590:Mfn1 UTSW 3 32563847 missense probably benign 0.00
R5629:Mfn1 UTSW 3 32561510 missense possibly damaging 0.83
R6110:Mfn1 UTSW 3 32563024 missense probably benign 0.01
R6114:Mfn1 UTSW 3 32563836 missense probably damaging 1.00
R6560:Mfn1 UTSW 3 32569516 missense probably damaging 0.96
R6891:Mfn1 UTSW 3 32577103 missense possibly damaging 0.49
R7053:Mfn1 UTSW 3 32531965 missense probably benign 0.00
R7071:Mfn1 UTSW 3 32568395 missense probably benign 0.00
R8190:Mfn1 UTSW 3 32568389 missense possibly damaging 0.88
R8998:Mfn1 UTSW 3 32569534 missense possibly damaging 0.79
R8999:Mfn1 UTSW 3 32569534 missense possibly damaging 0.79
R9255:Mfn1 UTSW 3 32544138 missense possibly damaging 0.91
R9619:Mfn1 UTSW 3 32574329 missense possibly damaging 0.50
Z1177:Mfn1 UTSW 3 32564291 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCATTGTTTGGAAGGCAAGAC -3'
(R):5'- CGGCTTTATGAGACAGACATACAC -3'

Sequencing Primer
(F):5'- GCATTGTTTGGAAGGCAAGACATTAC -3'
(R):5'- ACAGACATACACAAATAAATAGGCAG -3'
Posted On 2019-06-26