Incidental Mutation 'R7182:Trpc3'
ID 559027
Institutional Source Beutler Lab
Gene Symbol Trpc3
Ensembl Gene ENSMUSG00000027716
Gene Name transient receptor potential cation channel, subfamily C, member 3
Synonyms Trp3, Trrp3, Trcp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 36620482-36690167 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36655109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 406 (Q406R)
Ref Sequence ENSEMBL: ENSMUSP00000029271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029271]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029271
AA Change: Q406R

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000029271
Gene: ENSMUSG00000027716
AA Change: Q406R

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 47 68 N/A INTRINSIC
ANK 100 129 2.47e2 SMART
ANK 135 163 1.97e1 SMART
ANK 221 250 1.13e1 SMART
Pfam:TRP_2 256 318 3e-28 PFAM
transmembrane domain 414 433 N/A INTRINSIC
Pfam:Ion_trans 443 744 4.4e-34 PFAM
Pfam:PKD_channel 486 739 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous knockout mice or mice heterozygoous for a point mutation in exon 7 display an abnormal gait. Abnormal nervous system electrophysiology is also described. An A1903G point mutation in exon 7 results in homozygous lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Trpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Trpc3 APN 3 36640639 missense possibly damaging 0.95
IGL01701:Trpc3 APN 3 36671594 missense possibly damaging 0.92
IGL02254:Trpc3 APN 3 36651520 missense probably null 0.98
IGL02723:Trpc3 APN 3 36650228 missense probably benign 0.02
IGL02816:Trpc3 APN 3 36651702 missense probably damaging 1.00
IGL02867:Trpc3 APN 3 36640701 missense probably benign 0.10
IGL02929:Trpc3 APN 3 36638474 nonsense probably null
IGL03076:Trpc3 APN 3 36640655 missense probably damaging 1.00
R0032:Trpc3 UTSW 3 36644256 missense probably damaging 1.00
R0032:Trpc3 UTSW 3 36644256 missense probably damaging 1.00
R0115:Trpc3 UTSW 3 36624417 missense probably benign 0.05
R0481:Trpc3 UTSW 3 36624417 missense probably benign 0.05
R0645:Trpc3 UTSW 3 36671505 missense probably benign 0.00
R0694:Trpc3 UTSW 3 36671555 missense possibly damaging 0.48
R1190:Trpc3 UTSW 3 36671348 missense probably benign 0.00
R1635:Trpc3 UTSW 3 36640627 missense probably damaging 1.00
R1828:Trpc3 UTSW 3 36638546 missense possibly damaging 0.95
R2204:Trpc3 UTSW 3 36650149 missense possibly damaging 0.79
R2937:Trpc3 UTSW 3 36634383 nonsense probably null
R3732:Trpc3 UTSW 3 36638559 missense probably benign
R3732:Trpc3 UTSW 3 36638559 missense probably benign
R3733:Trpc3 UTSW 3 36638559 missense probably benign
R4063:Trpc3 UTSW 3 36671023 missense probably damaging 1.00
R4270:Trpc3 UTSW 3 36662925 nonsense probably null
R4807:Trpc3 UTSW 3 36634382 missense probably benign 0.00
R4996:Trpc3 UTSW 3 36662818 missense probably benign 0.00
R5098:Trpc3 UTSW 3 36662898 missense probably benign 0.07
R5139:Trpc3 UTSW 3 36671557 missense possibly damaging 0.46
R5251:Trpc3 UTSW 3 36670954 missense probably damaging 1.00
R5337:Trpc3 UTSW 3 36638370 intron probably benign
R5891:Trpc3 UTSW 3 36671022 missense probably damaging 1.00
R6512:Trpc3 UTSW 3 36662758 missense possibly damaging 0.59
R6618:Trpc3 UTSW 3 36640695 missense possibly damaging 0.82
R6750:Trpc3 UTSW 3 36624393 missense probably damaging 1.00
R6950:Trpc3 UTSW 3 36638590 missense probably damaging 1.00
R6986:Trpc3 UTSW 3 36655016 critical splice donor site probably null
R7031:Trpc3 UTSW 3 36621310 missense probably benign
R7100:Trpc3 UTSW 3 36650067 missense probably benign 0.00
R7211:Trpc3 UTSW 3 36640733 missense possibly damaging 0.81
R7214:Trpc3 UTSW 3 36650137 missense possibly damaging 0.94
R7284:Trpc3 UTSW 3 36624413 missense probably damaging 0.98
R7468:Trpc3 UTSW 3 36624416 missense probably damaging 0.99
R7652:Trpc3 UTSW 3 36638528 missense probably benign 0.06
R7815:Trpc3 UTSW 3 36655145 missense probably benign 0.28
R7833:Trpc3 UTSW 3 36640672 missense probably damaging 0.96
R7977:Trpc3 UTSW 3 36644169 missense probably benign 0.13
R7987:Trpc3 UTSW 3 36644169 missense probably benign 0.13
R8778:Trpc3 UTSW 3 36670921 missense probably damaging 0.99
R8959:Trpc3 UTSW 3 36655109 missense probably benign 0.02
R9072:Trpc3 UTSW 3 36640682 missense probably benign 0.01
R9175:Trpc3 UTSW 3 36655130 missense probably benign 0.15
R9401:Trpc3 UTSW 3 36621354 nonsense probably null
R9429:Trpc3 UTSW 3 36651628 missense probably benign 0.01
R9563:Trpc3 UTSW 3 36651534 missense probably benign 0.03
R9571:Trpc3 UTSW 3 36640760 missense probably damaging 1.00
R9711:Trpc3 UTSW 3 36638564 missense possibly damaging 0.81
Z1177:Trpc3 UTSW 3 36621279 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTAAAATGCAGAGCCAACGAG -3'
(R):5'- CCACCTTCTAGGAAGCAAGTTTG -3'

Sequencing Primer
(F):5'- CAACGAGGTGGGAGCCTG -3'
(R):5'- CTTCTAGGAAGCAAGTTTGAACAATG -3'
Posted On 2019-06-26