Incidental Mutation 'R0589:Trem1'
ID55903
Institutional Source Beutler Lab
Gene Symbol Trem1
Ensembl Gene ENSMUSG00000042265
Gene Nametriggering receptor expressed on myeloid cells 1
Synonyms
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0589 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location48232768-48246924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48237217 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 90 (D90G)
Ref Sequence ENSEMBL: ENSMUSP00000038636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048782] [ENSMUST00000113251]
PDB Structure
Crystal Structure of Mouse Triggering Receptor Expressed on Myeloid Cells 1 (TREM-1) at 1.76 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048782
AA Change: D90G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038636
Gene: ENSMUSG00000042265
AA Change: D90G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 134 1.25e-4 SMART
low complexity region 159 170 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113251
SMART Domains Protein: ENSMUSP00000108877
Gene: ENSMUSG00000042265

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
transmembrane domain 83 105 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor belonging to the Ig superfamily that is expressed on myeloid cells. This protein amplifies neutrophil and monocyte-mediated inflammatory responses triggered by bacterial and fungal infections by stimulating release of pro-inflammatory chemokines and cytokines, as well as increased surface expression of cell activation markers. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit decreased susceptibility to DEN induced tumors and liver damage. Mice homozygous for a knock-out allele of Trem1 and Trem3 exhibit increased susceptibility to P. aeruginosa infection with reduced neutrophil transepithelial migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,942,268 A1202E probably damaging Het
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Camk2a G A 18: 60,963,964 probably null Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Gpx3 A G 11: 54,909,503 I208V probably benign Het
Grk3 A G 5: 112,928,763 probably benign Het
Heatr9 T C 11: 83,514,690 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Marf1 C A 16: 14,142,055 probably benign Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr1220 A G 2: 89,097,262 F222L probably benign Het
Olfr531 T G 7: 140,400,900 S49R possibly damaging Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Pgbd1 G A 13: 21,434,430 T19I possibly damaging Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Trem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Trem1 APN 17 48237249 missense probably benign 0.14
IGL01729:Trem1 APN 17 48244575 missense possibly damaging 0.90
IGL01756:Trem1 APN 17 48237113 nonsense probably null
IGL02348:Trem1 APN 17 48232796 start codon destroyed probably null 1.00
IGL02720:Trem1 APN 17 48232841 missense probably benign 0.03
R1807:Trem1 UTSW 17 48241635 nonsense probably null
R1878:Trem1 UTSW 17 48241488 missense possibly damaging 0.83
R4648:Trem1 UTSW 17 48244562 missense probably benign 0.10
R5121:Trem1 UTSW 17 48232836 missense probably null 0.00
R5387:Trem1 UTSW 17 48241513 missense possibly damaging 0.92
R5623:Trem1 UTSW 17 48237055 missense probably damaging 1.00
R5953:Trem1 UTSW 17 48237192 missense probably benign 0.01
R6538:Trem1 UTSW 17 48237090 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CGTCATTCCCTACAGAGCCTGATTC -3'
(R):5'- CAATAGCTCCATTCATGTCTGGCCC -3'

Sequencing Primer
(F):5'- GAAGTCAAAGCTGCCATTGTTC -3'
(R):5'- cattcatgtctGGCCCTCTCTG -3'
Posted On2013-07-11