Incidental Mutation 'R7182:Scnm1'
ID 559031
Institutional Source Beutler Lab
Gene Symbol Scnm1
Ensembl Gene ENSMUSG00000092607
Gene Name sodium channel modifier 1
Synonyms Scnm1-ps, 3110001I17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027013; MGI: 1341284; Ensembl: ENSMUST00000145135

Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 95129536-95134011 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95133854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 14 (N14K)
Ref Sequence ENSEMBL: ENSMUSP00000134337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005769] [ENSMUST00000066386] [ENSMUST00000107227] [ENSMUST00000172572] [ENSMUST00000173462]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005769
SMART Domains Protein: ENSMUSP00000005769
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 4 143 2.7e-62 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066386
SMART Domains Protein: ENSMUSP00000067811
Gene: ENSMUSG00000053769

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LysM 41 85 2.58e-7 SMART
low complexity region 100 108 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107227
SMART Domains Protein: ENSMUSP00000102846
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 4.4e-72 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172572
AA Change: N14K

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134337
Gene: ENSMUSG00000092607
AA Change: N14K

DomainStartEndE-ValueType
Pfam:zf-SCNM1 44 70 7.6e-19 PFAM
low complexity region 133 148 N/A INTRINSIC
low complexity region 172 179 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173462
AA Change: N14K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133769
Gene: ENSMUSG00000092607
AA Change: N14K

DomainStartEndE-ValueType
Blast:ZnF_C2H2 42 68 2e-7 BLAST
Meta Mutation Damage Score 0.1629 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: Mutations in the voltage-gated sodium channel gene Scn8a lead to neurological problems in mice. For one particular mutation, Scn8amedJ, mice live to adulthood but have tremors and muscle weakness, among other problems, in all strains except those derived from C57BL6 mice. In these strains, the product of the Scnm1 gene (229 aa) partially overcomes the effects of the Scn8amedJ mutation. However, in C57BL6-derived mice, a one nt change in the penultimate exon creates a premature stop codon, truncating the Scnm1 protein at 186 aa. This truncated protein lacks the ability to overcome the effects of the Scn8amedJ mutation, and these mice suffer paralysis and juvenile death. [provided by RefSeq, Jul 2009]
PHENOTYPE: The Scnm1 locus influences the severity of the Scn8amed-J phenotype. Mice carrying the recesive susceptibility allele of the modifier are paralyzed and do not survive beyond 1 month. Mice carryimg the resistant allele display progressive dystonia with ataxia and live more than 1.5 years. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Scnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02964:Scnm1 APN 3 95133037 missense probably benign 0.07
R1917:Scnm1 UTSW 3 95130273 missense possibly damaging 0.59
R5538:Scnm1 UTSW 3 95129755 utr 3 prime probably benign
R5888:Scnm1 UTSW 3 95130285 missense probably benign 0.06
R5955:Scnm1 UTSW 3 95130285 missense probably benign 0.06
R5956:Scnm1 UTSW 3 95130285 missense probably benign 0.06
R6082:Scnm1 UTSW 3 95130285 missense probably benign 0.06
R6086:Scnm1 UTSW 3 95130285 missense probably benign 0.06
R7206:Scnm1 UTSW 3 95133894 start codon destroyed probably null 1.00
R7605:Scnm1 UTSW 3 95132875 missense probably benign 0.03
R8517:Scnm1 UTSW 3 95132823 critical splice donor site probably null
Z1176:Scnm1 UTSW 3 95130341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTCCGTTTCTGCAGGG -3'
(R):5'- TCATCCCCGGAAGTACAGATTC -3'

Sequencing Primer
(F):5'- GACGGATGGAAATGAAATAGTATGG -3'
(R):5'- CCGGAAGTACAGATTCAACAAG -3'
Posted On 2019-06-26