Incidental Mutation 'R7182:Pigk'
ID 559033
Institutional Source Beutler Lab
Gene Symbol Pigk
Ensembl Gene ENSMUSG00000039047
Gene Name phosphatidylinositol glycan anchor biosynthesis, class K
Synonyms 3000001O05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 152714100-152980408 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 152722551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 72 (V72I)
Ref Sequence ENSEMBL: ENSMUSP00000045351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045029] [ENSMUST00000159899] [ENSMUST00000161596] [ENSMUST00000162642] [ENSMUST00000200224]
AlphaFold Q9CXY9
Predicted Effect possibly damaging
Transcript: ENSMUST00000045029
AA Change: V72I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045351
Gene: ENSMUSG00000039047
AA Change: V72I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Peptidase_C13 45 183 2.4e-25 PFAM
Pfam:Peptidase_C13 203 353 2.2e-17 PFAM
transmembrane domain 411 430 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159899
AA Change: V72I

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123772
Gene: ENSMUSG00000039047
AA Change: V72I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Peptidase_C13 45 306 1.6e-47 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161596
AA Change: V72I

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123753
Gene: ENSMUSG00000039047
AA Change: V72I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Peptidase_C13 45 306 5.5e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162642
AA Change: V72I

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123899
Gene: ENSMUSG00000039047
AA Change: V72I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Peptidase_C13 45 306 1.5e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200224
AA Change: V72I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142966
Gene: ENSMUSG00000039047
AA Change: V72I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Meta Mutation Damage Score 0.1170 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cysteine protease family C13 that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is a member of the multisubunit enzyme, GPI transamidase and is thought to be its enzymatic component. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Pigk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pigk APN 3 152747632 nonsense probably null
IGL00668:Pigk APN 3 152742536 missense possibly damaging 0.50
IGL01335:Pigk APN 3 152742536 missense probably benign 0.30
IGL01657:Pigk APN 3 152722520 missense probably damaging 1.00
IGL01813:Pigk APN 3 152742519 missense probably damaging 1.00
IGL02426:Pigk APN 3 152742483 splice site probably null
IGL02871:Pigk APN 3 152766516 missense probably damaging 1.00
IGL02963:Pigk APN 3 152766461 nonsense probably null
R0135:Pigk UTSW 3 152744706 splice site probably benign
R1750:Pigk UTSW 3 152744464 missense probably damaging 1.00
R1766:Pigk UTSW 3 152740156 missense probably damaging 1.00
R1990:Pigk UTSW 3 152744494 missense probably damaging 1.00
R1991:Pigk UTSW 3 152744494 missense probably damaging 1.00
R2010:Pigk UTSW 3 152766514 missense probably damaging 1.00
R2864:Pigk UTSW 3 152722552 missense probably damaging 1.00
R3883:Pigk UTSW 3 152714195 missense probably benign 0.00
R4153:Pigk UTSW 3 152740129 missense probably damaging 1.00
R4730:Pigk UTSW 3 152742566 nonsense probably null
R4911:Pigk UTSW 3 152740204 missense probably damaging 1.00
R4942:Pigk UTSW 3 152744517 missense probably damaging 1.00
R5323:Pigk UTSW 3 152738200 missense probably damaging 1.00
R5655:Pigk UTSW 3 152740221 missense probably damaging 1.00
R5941:Pigk UTSW 3 152766513 missense possibly damaging 0.94
R5986:Pigk UTSW 3 152740849 missense probably benign 0.00
R6391:Pigk UTSW 3 152740849 missense probably benign
R7349:Pigk UTSW 3 152747601 missense probably benign 0.04
R7947:Pigk UTSW 3 152747767 missense probably benign 0.00
R7971:Pigk UTSW 3 152744539 missense probably benign 0.26
R8915:Pigk UTSW 3 152766461 missense probably benign 0.00
R8932:Pigk UTSW 3 152740234 missense possibly damaging 0.64
Z1177:Pigk UTSW 3 152766472 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTGAAATGCTTTCTTCAGGC -3'
(R):5'- AGGAGATACCCAGAGCTTACC -3'

Sequencing Primer
(F):5'- CATTTCCACATAGACTTGAAGTGCGG -3'
(R):5'- TCATGTGCACTGTGGCCCTAAG -3'
Posted On 2019-06-26