Incidental Mutation 'R7182:Ano2'
ID 559042
Institutional Source Beutler Lab
Gene Symbol Ano2
Ensembl Gene ENSMUSG00000038115
Gene Name anoctamin 2
Synonyms Tmem16b
MMRRC Submission 045234-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.114) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 125667382-126017089 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125767256 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 229 (L229Q)
Ref Sequence ENSEMBL: ENSMUSP00000125303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160496]
AlphaFold Q8CFW1
Predicted Effect probably damaging
Transcript: ENSMUST00000160496
AA Change: L229Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125303
Gene: ENSMUSG00000038115
AA Change: L229Q

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:Anoct_dimer 91 348 5.7e-78 PFAM
Pfam:Anoctamin 351 941 6.7e-138 PFAM
low complexity region 964 991 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000125426
Gene: ENSMUSG00000038115
AA Change: L198Q

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:Anoctamin 262 425 1.9e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ANO2 belongs to a family of calcium-activated chloride channels (CaCCs) (reviewed by Hartzell et al., 2009 [PubMed 19015192]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack calcium-activated chloride currents in the main olfactory epithelium and vomeronasal organ but normal olfaction in behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,578 (GRCm39) V323A unknown Het
AC117241.1 A G 17: 7,620,087 (GRCm39) V158A unknown Het
Acadm A G 3: 153,647,518 (GRCm39) probably null Het
Adcy10 T G 1: 165,371,039 (GRCm39) probably null Het
Aldh6a1 C T 12: 84,488,605 (GRCm39) A94T probably benign Het
Cacna1h C T 17: 25,596,629 (GRCm39) R1828H probably damaging Het
Ccdc33 A T 9: 57,941,456 (GRCm39) probably null Het
Cep112 A C 11: 108,573,670 (GRCm39) D6A probably benign Het
Chd9 T C 8: 91,733,250 (GRCm39) F1373S unknown Het
Cog5 T C 12: 31,735,707 (GRCm39) L158P probably damaging Het
Col6a3 G A 1: 90,731,400 (GRCm39) Q1618* probably null Het
Dlg5 A G 14: 24,294,924 (GRCm39) V3A Het
Dnah7a T A 1: 53,659,620 (GRCm39) probably null Het
Dpp10 A T 1: 123,268,880 (GRCm39) H716Q probably benign Het
Epor A G 9: 21,874,625 (GRCm39) F35L probably benign Het
Ergic1 A T 17: 26,873,856 (GRCm39) Y92F Het
Fam98a G A 17: 75,846,013 (GRCm39) Q273* probably null Het
Fhdc1 G A 3: 84,356,157 (GRCm39) T429I probably damaging Het
Fmnl2 T A 2: 52,997,453 (GRCm39) L468Q unknown Het
Fmnl3 C T 15: 99,219,663 (GRCm39) R695Q probably damaging Het
Gabrg2 T C 11: 41,811,333 (GRCm39) M271V probably damaging Het
Garin4 C T 1: 190,895,548 (GRCm39) R365H probably damaging Het
Gk5 G T 9: 96,001,579 (GRCm39) V26L possibly damaging Het
Gm14412 A C 2: 177,007,408 (GRCm39) N162K probably benign Het
Gm3604 T C 13: 62,519,689 (GRCm39) D22G probably damaging Het
Gm5565 G T 5: 146,094,865 (GRCm39) H294N probably benign Het
Hsf2 T A 10: 57,381,272 (GRCm39) D287E possibly damaging Het
Ift70b A T 2: 75,768,293 (GRCm39) Y153* probably null Het
Impdh2 G A 9: 108,440,407 (GRCm39) R231H possibly damaging Het
Irak3 T C 10: 120,002,416 (GRCm39) H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,648,765 (GRCm39) probably null Het
Lrch3 T A 16: 32,814,149 (GRCm39) D551E probably benign Het
Manba A T 3: 135,273,274 (GRCm39) N736I probably benign Het
Map2 A G 1: 66,451,812 (GRCm39) D234G possibly damaging Het
Mdk C A 2: 91,761,197 (GRCm39) K121N unknown Het
Mfn1 T A 3: 32,618,369 (GRCm39) L526Q probably damaging Het
Mfsd2b A G 12: 4,916,157 (GRCm39) probably null Het
Mnat1 G T 12: 73,277,452 (GRCm39) E233* probably null Het
Mtmr4 T C 11: 87,495,431 (GRCm39) probably null Het
Mtrf1 A G 14: 79,660,904 (GRCm39) E432G possibly damaging Het
Muc5b C T 7: 141,396,382 (GRCm39) R165C unknown Het
Naip6 T A 13: 100,452,657 (GRCm39) I135F probably benign Het
Nod2 A G 8: 89,390,460 (GRCm39) T256A probably benign Het
Notch4 T A 17: 34,802,473 (GRCm39) V1298E probably damaging Het
Nudc G T 4: 133,261,776 (GRCm39) D169E possibly damaging Het
Obscn A T 11: 58,925,927 (GRCm39) I5602N probably damaging Het
Or5b114-ps1 G A 19: 13,353,208 (GRCm39) G294E unknown Het
Osbpl10 G A 9: 114,896,319 (GRCm39) D18N probably damaging Het
Pigk G A 3: 152,428,188 (GRCm39) V72I possibly damaging Het
Prl8a6 C T 13: 27,621,153 (GRCm39) E26K probably damaging Het
Prpf8 A G 11: 75,381,553 (GRCm39) Y318C possibly damaging Het
Rab13 A G 3: 90,132,070 (GRCm39) D159G possibly damaging Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ryr2 T C 13: 11,774,643 (GRCm39) H1171R probably benign Het
Scn4a T A 11: 106,221,134 (GRCm39) I842F probably benign Het
Scnm1 A T 3: 95,041,165 (GRCm39) N14K possibly damaging Het
Serinc1 A T 10: 57,400,457 (GRCm39) I137N probably benign Het
Slc30a3 T C 5: 31,244,169 (GRCm39) Q371R probably benign Het
Slc30a3 A C 5: 31,247,014 (GRCm39) M103R probably damaging Het
Slco1a1 A T 6: 141,857,565 (GRCm39) C589S probably damaging Het
Slco1b2 A G 6: 141,602,656 (GRCm39) Y203C probably damaging Het
Spty2d1 A T 7: 46,648,271 (GRCm39) D219E probably benign Het
Svep1 A T 4: 58,043,991 (GRCm39) S3552T probably benign Het
Tmem62 A G 2: 120,835,224 (GRCm39) I516M probably benign Het
Trim61 A T 8: 65,466,266 (GRCm39) S332T probably damaging Het
Trmt10b A C 4: 45,308,520 (GRCm39) T227P probably benign Het
Trpc3 T C 3: 36,709,258 (GRCm39) Q406R probably benign Het
Ush2a A T 1: 188,485,740 (GRCm39) Y2950F probably benign Het
Usp32 C T 11: 84,930,996 (GRCm39) G478D probably benign Het
Wdfy3 A G 5: 102,091,758 (GRCm39) L527P possibly damaging Het
Wdr73 A G 7: 80,543,426 (GRCm39) V163A possibly damaging Het
Other mutations in Ano2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ano2 APN 6 125,990,216 (GRCm39) missense probably damaging 1.00
IGL01387:Ano2 APN 6 125,990,240 (GRCm39) missense probably damaging 0.99
IGL01772:Ano2 APN 6 126,013,821 (GRCm39) missense probably damaging 0.98
IGL01931:Ano2 APN 6 125,959,708 (GRCm39) missense probably damaging 1.00
IGL02066:Ano2 APN 6 125,667,702 (GRCm39) missense probably benign 0.07
IGL02410:Ano2 APN 6 125,792,496 (GRCm39) critical splice acceptor site probably null
IGL02526:Ano2 APN 6 125,849,714 (GRCm39) critical splice donor site probably null
IGL03116:Ano2 APN 6 125,957,134 (GRCm39) nonsense probably null
IGL03183:Ano2 APN 6 125,687,592 (GRCm39) missense probably benign
IGL03391:Ano2 APN 6 125,784,802 (GRCm39) missense probably damaging 1.00
R0257:Ano2 UTSW 6 125,857,676 (GRCm39) missense probably benign 0.05
R0462:Ano2 UTSW 6 125,689,238 (GRCm39) missense probably benign 0.26
R0594:Ano2 UTSW 6 125,959,728 (GRCm39) missense probably damaging 1.00
R1072:Ano2 UTSW 6 126,016,287 (GRCm39) missense probably damaging 1.00
R1099:Ano2 UTSW 6 125,784,810 (GRCm39) missense probably damaging 1.00
R1436:Ano2 UTSW 6 125,844,134 (GRCm39) critical splice donor site probably null
R1468:Ano2 UTSW 6 125,773,227 (GRCm39) missense probably damaging 1.00
R1468:Ano2 UTSW 6 125,773,227 (GRCm39) missense probably damaging 1.00
R1822:Ano2 UTSW 6 125,840,420 (GRCm39) missense probably damaging 1.00
R1901:Ano2 UTSW 6 125,849,647 (GRCm39) missense probably damaging 1.00
R1902:Ano2 UTSW 6 125,849,647 (GRCm39) missense probably damaging 1.00
R1911:Ano2 UTSW 6 125,990,654 (GRCm39) missense probably benign 0.00
R2040:Ano2 UTSW 6 126,016,471 (GRCm39) missense probably benign 0.13
R2192:Ano2 UTSW 6 125,992,502 (GRCm39) missense probably damaging 1.00
R2307:Ano2 UTSW 6 125,969,849 (GRCm39) missense probably benign 0.00
R2698:Ano2 UTSW 6 125,689,309 (GRCm39) missense probably benign 0.01
R2878:Ano2 UTSW 6 125,840,481 (GRCm39) missense probably damaging 1.00
R3151:Ano2 UTSW 6 125,990,280 (GRCm39) splice site probably null
R4004:Ano2 UTSW 6 125,990,242 (GRCm39) missense probably damaging 1.00
R4664:Ano2 UTSW 6 125,840,501 (GRCm39) missense probably benign 0.07
R4684:Ano2 UTSW 6 125,767,304 (GRCm39) missense probably benign 0.00
R4685:Ano2 UTSW 6 125,957,087 (GRCm39) nonsense probably null
R4686:Ano2 UTSW 6 125,767,254 (GRCm39) missense probably benign 0.10
R4852:Ano2 UTSW 6 125,959,886 (GRCm39) missense possibly damaging 0.95
R4923:Ano2 UTSW 6 125,880,018 (GRCm39) utr 3 prime probably benign
R5488:Ano2 UTSW 6 126,016,216 (GRCm39) missense possibly damaging 0.46
R5513:Ano2 UTSW 6 126,016,285 (GRCm39) missense possibly damaging 0.88
R5699:Ano2 UTSW 6 125,849,703 (GRCm39) missense probably damaging 1.00
R5876:Ano2 UTSW 6 126,016,242 (GRCm39) missense possibly damaging 0.92
R6175:Ano2 UTSW 6 125,969,918 (GRCm39) missense probably benign 0.15
R6219:Ano2 UTSW 6 125,792,553 (GRCm39) missense probably damaging 1.00
R6613:Ano2 UTSW 6 125,783,619 (GRCm39) splice site probably null
R6711:Ano2 UTSW 6 125,752,795 (GRCm39) missense probably damaging 1.00
R6982:Ano2 UTSW 6 125,969,856 (GRCm39) missense probably benign
R7153:Ano2 UTSW 6 125,969,906 (GRCm39) missense possibly damaging 0.73
R7312:Ano2 UTSW 6 126,016,460 (GRCm39) nonsense probably null
R7358:Ano2 UTSW 6 125,687,696 (GRCm39) missense probably benign
R7456:Ano2 UTSW 6 125,940,508 (GRCm39) missense probably benign 0.01
R7532:Ano2 UTSW 6 125,940,667 (GRCm39) missense probably damaging 1.00
R7607:Ano2 UTSW 6 125,689,382 (GRCm39) missense probably damaging 1.00
R7623:Ano2 UTSW 6 125,992,536 (GRCm39) nonsense probably null
R7690:Ano2 UTSW 6 125,990,161 (GRCm39) missense probably damaging 1.00
R8273:Ano2 UTSW 6 125,959,683 (GRCm39) missense probably damaging 1.00
R8389:Ano2 UTSW 6 125,957,132 (GRCm39) missense probably damaging 0.99
R8392:Ano2 UTSW 6 125,857,698 (GRCm39) missense probably benign 0.02
R8479:Ano2 UTSW 6 125,689,123 (GRCm39) missense possibly damaging 0.61
R8488:Ano2 UTSW 6 125,957,133 (GRCm39) missense probably damaging 1.00
R8746:Ano2 UTSW 6 125,840,513 (GRCm39) missense probably benign 0.14
R9136:Ano2 UTSW 6 125,959,962 (GRCm39) missense probably damaging 0.98
R9680:Ano2 UTSW 6 125,857,382 (GRCm39) critical splice acceptor site probably null
R9752:Ano2 UTSW 6 125,840,499 (GRCm39) missense probably damaging 1.00
Z1176:Ano2 UTSW 6 125,840,416 (GRCm39) nonsense probably null
Z1176:Ano2 UTSW 6 125,687,670 (GRCm39) missense probably benign
Z1177:Ano2 UTSW 6 125,992,610 (GRCm39) missense probably damaging 1.00
Z1177:Ano2 UTSW 6 125,990,170 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGACTGAGAGGAACTTC -3'
(R):5'- TCAGGCATGGAATGACACTGG -3'

Sequencing Primer
(F):5'- GAAAGAAACCTGCCTCTTATTCTTGC -3'
(R):5'- AATGACACTGGAGGTCTGCC -3'
Posted On 2019-06-26