Incidental Mutation 'R7182:Slco1b2'
ID559043
Institutional Source Beutler Lab
Gene Symbol Slco1b2
Ensembl Gene ENSMUSG00000030236
Gene Namesolute carrier organic anion transporter family, member 1b2
Synonyms7330442B20Rik, Slc21a6, mlst-1, Oatp1b2, Slc21a10
MMRRC Submission
Accession Numbers

Genbank: NM_020495; MGI: 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7182 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location141629518-141686646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141656930 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 203 (Y203C)
Ref Sequence ENSEMBL: ENSMUSP00000044326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042812] [ENSMUST00000203597]
Predicted Effect probably damaging
Transcript: ENSMUST00000042812
AA Change: Y203C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044326
Gene: ENSMUSG00000030236
AA Change: Y203C

DomainStartEndE-ValueType
Pfam:MFS_1 27 443 6.1e-21 PFAM
KAZAL 457 501 8.81e-4 SMART
transmembrane domain 620 642 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203597
AA Change: Y203C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144747
Gene: ENSMUSG00000030236
AA Change: Y203C

DomainStartEndE-ValueType
Pfam:MFS_1 27 405 8.4e-19 PFAM
KAZAL 422 466 5.7e-6 SMART
transmembrane domain 497 519 N/A INTRINSIC
transmembrane domain 534 556 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
Meta Mutation Damage Score 0.7814 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a liver-specific member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of endogenous and xenobiotic compounds and plays a critical role in bile acid and bilirubin transport. Mutations in this gene are a cause of Rotor type hyperbilirubinemia. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null mutation display slight abnormalities in blood chemistry and are resistant to injury induced by some classes of hepatotoxins. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Slco1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Slco1b2 APN 6 141655352 missense probably damaging 0.99
IGL01583:Slco1b2 APN 6 141663672 missense possibly damaging 0.85
IGL01909:Slco1b2 APN 6 141648586 missense probably damaging 1.00
IGL01943:Slco1b2 APN 6 141676286 missense possibly damaging 0.71
IGL01952:Slco1b2 APN 6 141671230 missense probably benign 0.01
IGL02186:Slco1b2 APN 6 141634545 splice site probably benign
IGL02309:Slco1b2 APN 6 141672281 missense probably damaging 1.00
IGL02352:Slco1b2 APN 6 141685525 missense probably damaging 0.96
IGL02359:Slco1b2 APN 6 141685525 missense probably damaging 0.96
IGL02524:Slco1b2 APN 6 141671072 missense probably benign 0.03
IGL02701:Slco1b2 APN 6 141685545 missense probably benign 0.35
IGL02962:Slco1b2 APN 6 141648553 missense probably damaging 0.99
3-1:Slco1b2 UTSW 6 141669463 missense probably benign 0.01
IGL03052:Slco1b2 UTSW 6 141648585 missense probably benign 0.13
R0112:Slco1b2 UTSW 6 141671111 missense probably benign 0.30
R0116:Slco1b2 UTSW 6 141669388 missense probably benign 0.22
R0515:Slco1b2 UTSW 6 141669410 missense possibly damaging 0.74
R0831:Slco1b2 UTSW 6 141685446 missense probably benign 0.01
R0965:Slco1b2 UTSW 6 141685596 missense probably damaging 1.00
R1115:Slco1b2 UTSW 6 141683254 missense probably benign 0.03
R1452:Slco1b2 UTSW 6 141672200 missense probably benign 0.02
R1630:Slco1b2 UTSW 6 141656821 missense probably damaging 0.99
R1885:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R1886:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R1975:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R2394:Slco1b2 UTSW 6 141669374 missense probably damaging 0.99
R3408:Slco1b2 UTSW 6 141676256 missense probably benign 0.01
R3793:Slco1b2 UTSW 6 141676307 missense probably damaging 1.00
R4560:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4561:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4563:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4807:Slco1b2 UTSW 6 141669469 missense probably damaging 1.00
R4820:Slco1b2 UTSW 6 141685432 missense probably benign 0.05
R4861:Slco1b2 UTSW 6 141671222 missense possibly damaging 0.95
R4861:Slco1b2 UTSW 6 141671222 missense possibly damaging 0.95
R4889:Slco1b2 UTSW 6 141656743 intron probably benign
R4914:Slco1b2 UTSW 6 141669370 missense probably benign 0.14
R4918:Slco1b2 UTSW 6 141669370 missense probably benign 0.14
R4977:Slco1b2 UTSW 6 141657557 missense probably benign 0.01
R5607:Slco1b2 UTSW 6 141685586 missense probably benign
R6082:Slco1b2 UTSW 6 141663670 missense probably benign 0.08
R6118:Slco1b2 UTSW 6 141657510 missense probably benign 0.03
R6522:Slco1b2 UTSW 6 141655419 critical splice donor site probably null
R7054:Slco1b2 UTSW 6 141672248 missense probably damaging 1.00
R7763:Slco1b2 UTSW 6 141676224 nonsense probably null
R8891:Slco1b2 UTSW 6 141683267 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AGCCAAGTTTGTGGAATTTCTG -3'
(R):5'- TTCAGTCAGAATCAAAGCGCAC -3'

Sequencing Primer
(F):5'- CAAGTTTGTGGAATTTCTGGTATTTG -3'
(R):5'- CAGAACATGCTCTTCTGGCATACATG -3'
Posted On2019-06-26