Incidental Mutation 'R7182:Epor'
ID 559051
Institutional Source Beutler Lab
Gene Symbol Epor
Ensembl Gene ENSMUSG00000006235
Gene Name erythropoietin receptor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 21958897-21963506 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21963329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 35 (F35L)
Ref Sequence ENSEMBL: ENSMUSP00000006397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006397] [ENSMUST00000213181]
AlphaFold P14753
Predicted Effect probably benign
Transcript: ENSMUST00000006397
AA Change: F35L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000006397
Gene: ENSMUSG00000006235
AA Change: F35L

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 37 139 9.1e-30 PFAM
FN3 144 227 2.48e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
low complexity region 434 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213181
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the erythropoietin receptor which is a member of the cytokine receptor family. Upon erythropoietin binding, this receptor activates Jak2 tyrosine kinase which activates different intracellular pathways including: Ras/MAP kinase, phosphatidylinositol 3-kinase and STAT transcription factors. The stimulated erythropoietin receptor appears to have a role in erythroid cell survival. Defects in the erythropoietin receptor may produce erythroleukemia and familial erythrocytosis. Dysregulation of this gene may affect the growth of certain tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this locus affect erythropoiesis. Targeted null mutants die at embryonic day 11-12.5 with severe anemia. Mutants with truncated alleles are viable with mild changes in erythropoiesis. A human mutation replacement allele produces polycythemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Epor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Epor APN 9 21960591 missense possibly damaging 0.50
IGL01377:Epor APN 9 21959297 missense probably damaging 1.00
IGL01400:Epor APN 9 21959439 splice site probably null
IGL01462:Epor APN 9 21959456 missense probably damaging 1.00
R1741:Epor UTSW 9 21959771 missense probably damaging 1.00
R1983:Epor UTSW 9 21959400 missense probably benign 0.00
R2414:Epor UTSW 9 21959489 missense probably damaging 1.00
R2655:Epor UTSW 9 21960720 missense probably damaging 1.00
R2879:Epor UTSW 9 21959640 missense probably damaging 1.00
R4598:Epor UTSW 9 21961859 missense probably benign 0.00
R4599:Epor UTSW 9 21961859 missense probably benign 0.00
R5987:Epor UTSW 9 21962276 missense possibly damaging 0.83
R6462:Epor UTSW 9 21959255 missense probably benign 0.05
R7413:Epor UTSW 9 21963480 unclassified probably benign
R8717:Epor UTSW 9 21959445 missense probably benign 0.00
R9053:Epor UTSW 9 21959359 missense probably benign 0.28
R9108:Epor UTSW 9 21959579 missense probably damaging 1.00
R9494:Epor UTSW 9 21959226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTAAGCCTCTGCCCTG -3'
(R):5'- TAGAAGCTCCTGGTCAGCTG -3'

Sequencing Primer
(F):5'- TGAGCATCACTCCAGGGC -3'
(R):5'- TCCTGGTCAGCTGTGTCCG -3'
Posted On 2019-06-26