Incidental Mutation 'R7182:Impdh2'
ID559053
Institutional Source Beutler Lab
Gene Symbol Impdh2
Ensembl Gene ENSMUSG00000062867
Gene Nameinosine monophosphate dehydrogenase 2
SynonymsIMP dehydrogenase type II
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7182 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108560286-108565584 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108563208 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 231 (R231H)
Ref Sequence ENSEMBL: ENSMUSP00000079888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006851] [ENSMUST00000074208] [ENSMUST00000081111] [ENSMUST00000112155] [ENSMUST00000193421] [ENSMUST00000194381] [ENSMUST00000194904]
Predicted Effect probably benign
Transcript: ENSMUST00000006851
SMART Domains Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 597 761 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074208
SMART Domains Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283

DomainStartEndE-ValueType
Pfam:DUF498 61 169 9.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081111
AA Change: R231H

PolyPhen 2 Score 0.562 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079888
Gene: ENSMUSG00000062867
AA Change: R231H

DomainStartEndE-ValueType
IMPDH 28 504 7.39e-260 SMART
CBS 117 168 9.4e-7 SMART
CBS 184 232 1.57e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112155
SMART Domains Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 600 760 2.3e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193421
AA Change: R206H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142117
Gene: ENSMUSG00000062867
AA Change: R206H

DomainStartEndE-ValueType
IMPDH 28 248 1.3e-18 SMART
CBS 92 143 4.5e-9 SMART
CBS 159 207 7.6e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194381
Predicted Effect probably damaging
Transcript: ENSMUST00000194904
AA Change: R25H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142305
Gene: ENSMUSG00000062867
AA Change: R25H

DomainStartEndE-ValueType
IMPDH 1 319 5e-122 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities resulting in embryonic lethality around the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Impdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0032:Impdh2 UTSW 9 108561661 missense probably damaging 1.00
R0523:Impdh2 UTSW 9 108561819 splice site probably null
R0523:Impdh2 UTSW 9 108561820 missense possibly damaging 0.80
R0644:Impdh2 UTSW 9 108563637 missense possibly damaging 0.56
R0648:Impdh2 UTSW 9 108563466 missense probably benign 0.01
R0905:Impdh2 UTSW 9 108561097 unclassified probably benign
R1173:Impdh2 UTSW 9 108561829 missense probably benign 0.19
R1202:Impdh2 UTSW 9 108563187 missense probably damaging 1.00
R1441:Impdh2 UTSW 9 108564776 missense probably benign 0.12
R1818:Impdh2 UTSW 9 108563212 splice site probably null
R2141:Impdh2 UTSW 9 108565347 missense possibly damaging 0.50
R2173:Impdh2 UTSW 9 108565394 splice site probably null
R2438:Impdh2 UTSW 9 108560616 missense probably benign 0.06
R4061:Impdh2 UTSW 9 108562804 missense possibly damaging 0.46
R4273:Impdh2 UTSW 9 108564956 missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108564671 missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108565515 missense probably benign 0.00
R5073:Impdh2 UTSW 9 108563336 critical splice donor site probably null
R5896:Impdh2 UTSW 9 108563966 missense probably benign 0.06
R6315:Impdh2 UTSW 9 108563439 missense possibly damaging 0.66
R7172:Impdh2 UTSW 9 108560610 missense probably benign 0.00
R7241:Impdh2 UTSW 9 108563437 missense possibly damaging 0.78
R7640:Impdh2 UTSW 9 108565181 missense possibly damaging 0.84
R7969:Impdh2 UTSW 9 108562306 nonsense probably null
R8079:Impdh2 UTSW 9 108563325 missense probably benign 0.01
R8728:Impdh2 UTSW 9 108560363 unclassified probably benign
R8735:Impdh2 UTSW 9 108564779 critical splice donor site probably null
R8821:Impdh2 UTSW 9 108564758 missense probably damaging 0.99
R8831:Impdh2 UTSW 9 108564758 missense probably damaging 0.99
X0066:Impdh2 UTSW 9 108561787 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTGGCCTACAAGGTGGAAAG -3'
(R):5'- GGCAATCACCTCATTAAGTCCTG -3'

Sequencing Primer
(F):5'- TCACTCTATAGACCAGGCTGG -3'
(R):5'- TGCCTTATTTATAATGCAGCTTACC -3'
Posted On2019-06-26