Incidental Mutation 'R7182:Serinc1'
ID 559056
Institutional Source Beutler Lab
Gene Symbol Serinc1
Ensembl Gene ENSMUSG00000019877
Gene Name serine incorporator 1
Synonyms Tde2, TMS-2, 1500011D18Rik, Tde1l
MMRRC Submission 045234-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.667) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 57391870-57408573 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57400457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 137 (I137N)
Ref Sequence ENSEMBL: ENSMUSP00000020027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020027] [ENSMUST00000169122] [ENSMUST00000170062]
AlphaFold Q9QZI8
Predicted Effect probably benign
Transcript: ENSMUST00000020027
AA Change: I137N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020027
Gene: ENSMUSG00000019877
AA Change: I137N

DomainStartEndE-ValueType
Pfam:Serinc 16 451 9.5e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169122
AA Change: I137N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126561
Gene: ENSMUSG00000019877
AA Change: I137N

DomainStartEndE-ValueType
Pfam:Serinc 15 152 1.9e-50 PFAM
Pfam:Serinc 149 220 6.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170062
SMART Domains Protein: ENSMUSP00000127041
Gene: ENSMUSG00000019877

DomainStartEndE-ValueType
Pfam:Serinc 15 113 9.1e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype PHENOTYPE: Male homozygous mutant mice exhibited signs of growth retardation including decreased mean body weight and length total tissue mass and lean body mass. No other notable phenotype was observed for the homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,578 (GRCm39) V323A unknown Het
AC117241.1 A G 17: 7,620,087 (GRCm39) V158A unknown Het
Acadm A G 3: 153,647,518 (GRCm39) probably null Het
Adcy10 T G 1: 165,371,039 (GRCm39) probably null Het
Aldh6a1 C T 12: 84,488,605 (GRCm39) A94T probably benign Het
Ano2 T A 6: 125,767,256 (GRCm39) L229Q probably damaging Het
Cacna1h C T 17: 25,596,629 (GRCm39) R1828H probably damaging Het
Ccdc33 A T 9: 57,941,456 (GRCm39) probably null Het
Cep112 A C 11: 108,573,670 (GRCm39) D6A probably benign Het
Chd9 T C 8: 91,733,250 (GRCm39) F1373S unknown Het
Cog5 T C 12: 31,735,707 (GRCm39) L158P probably damaging Het
Col6a3 G A 1: 90,731,400 (GRCm39) Q1618* probably null Het
Dlg5 A G 14: 24,294,924 (GRCm39) V3A Het
Dnah7a T A 1: 53,659,620 (GRCm39) probably null Het
Dpp10 A T 1: 123,268,880 (GRCm39) H716Q probably benign Het
Epor A G 9: 21,874,625 (GRCm39) F35L probably benign Het
Ergic1 A T 17: 26,873,856 (GRCm39) Y92F Het
Fam98a G A 17: 75,846,013 (GRCm39) Q273* probably null Het
Fhdc1 G A 3: 84,356,157 (GRCm39) T429I probably damaging Het
Fmnl2 T A 2: 52,997,453 (GRCm39) L468Q unknown Het
Fmnl3 C T 15: 99,219,663 (GRCm39) R695Q probably damaging Het
Gabrg2 T C 11: 41,811,333 (GRCm39) M271V probably damaging Het
Garin4 C T 1: 190,895,548 (GRCm39) R365H probably damaging Het
Gk5 G T 9: 96,001,579 (GRCm39) V26L possibly damaging Het
Gm14412 A C 2: 177,007,408 (GRCm39) N162K probably benign Het
Gm3604 T C 13: 62,519,689 (GRCm39) D22G probably damaging Het
Gm5565 G T 5: 146,094,865 (GRCm39) H294N probably benign Het
Hsf2 T A 10: 57,381,272 (GRCm39) D287E possibly damaging Het
Ift70b A T 2: 75,768,293 (GRCm39) Y153* probably null Het
Impdh2 G A 9: 108,440,407 (GRCm39) R231H possibly damaging Het
Irak3 T C 10: 120,002,416 (GRCm39) H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,648,765 (GRCm39) probably null Het
Lrch3 T A 16: 32,814,149 (GRCm39) D551E probably benign Het
Manba A T 3: 135,273,274 (GRCm39) N736I probably benign Het
Map2 A G 1: 66,451,812 (GRCm39) D234G possibly damaging Het
Mdk C A 2: 91,761,197 (GRCm39) K121N unknown Het
Mfn1 T A 3: 32,618,369 (GRCm39) L526Q probably damaging Het
Mfsd2b A G 12: 4,916,157 (GRCm39) probably null Het
Mnat1 G T 12: 73,277,452 (GRCm39) E233* probably null Het
Mtmr4 T C 11: 87,495,431 (GRCm39) probably null Het
Mtrf1 A G 14: 79,660,904 (GRCm39) E432G possibly damaging Het
Muc5b C T 7: 141,396,382 (GRCm39) R165C unknown Het
Naip6 T A 13: 100,452,657 (GRCm39) I135F probably benign Het
Nod2 A G 8: 89,390,460 (GRCm39) T256A probably benign Het
Notch4 T A 17: 34,802,473 (GRCm39) V1298E probably damaging Het
Nudc G T 4: 133,261,776 (GRCm39) D169E possibly damaging Het
Obscn A T 11: 58,925,927 (GRCm39) I5602N probably damaging Het
Or5b114-ps1 G A 19: 13,353,208 (GRCm39) G294E unknown Het
Osbpl10 G A 9: 114,896,319 (GRCm39) D18N probably damaging Het
Pigk G A 3: 152,428,188 (GRCm39) V72I possibly damaging Het
Prl8a6 C T 13: 27,621,153 (GRCm39) E26K probably damaging Het
Prpf8 A G 11: 75,381,553 (GRCm39) Y318C possibly damaging Het
Rab13 A G 3: 90,132,070 (GRCm39) D159G possibly damaging Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ryr2 T C 13: 11,774,643 (GRCm39) H1171R probably benign Het
Scn4a T A 11: 106,221,134 (GRCm39) I842F probably benign Het
Scnm1 A T 3: 95,041,165 (GRCm39) N14K possibly damaging Het
Slc30a3 T C 5: 31,244,169 (GRCm39) Q371R probably benign Het
Slc30a3 A C 5: 31,247,014 (GRCm39) M103R probably damaging Het
Slco1a1 A T 6: 141,857,565 (GRCm39) C589S probably damaging Het
Slco1b2 A G 6: 141,602,656 (GRCm39) Y203C probably damaging Het
Spty2d1 A T 7: 46,648,271 (GRCm39) D219E probably benign Het
Svep1 A T 4: 58,043,991 (GRCm39) S3552T probably benign Het
Tmem62 A G 2: 120,835,224 (GRCm39) I516M probably benign Het
Trim61 A T 8: 65,466,266 (GRCm39) S332T probably damaging Het
Trmt10b A C 4: 45,308,520 (GRCm39) T227P probably benign Het
Trpc3 T C 3: 36,709,258 (GRCm39) Q406R probably benign Het
Ush2a A T 1: 188,485,740 (GRCm39) Y2950F probably benign Het
Usp32 C T 11: 84,930,996 (GRCm39) G478D probably benign Het
Wdfy3 A G 5: 102,091,758 (GRCm39) L527P possibly damaging Het
Wdr73 A G 7: 80,543,426 (GRCm39) V163A possibly damaging Het
Other mutations in Serinc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Serinc1 APN 10 57,399,204 (GRCm39) missense probably damaging 1.00
IGL02600:Serinc1 APN 10 57,399,127 (GRCm39) missense probably benign 0.23
IGL02666:Serinc1 APN 10 57,400,089 (GRCm39) splice site probably null
IGL02829:Serinc1 APN 10 57,400,061 (GRCm39) nonsense probably null
IGL03109:Serinc1 APN 10 57,399,165 (GRCm39) missense probably benign 0.22
Olive UTSW 10 57,393,306 (GRCm39) missense probably damaging 1.00
ANU74:Serinc1 UTSW 10 57,395,938 (GRCm39) missense probably benign 0.00
R0254:Serinc1 UTSW 10 57,399,304 (GRCm39) missense probably damaging 0.99
R0453:Serinc1 UTSW 10 57,393,306 (GRCm39) missense probably damaging 1.00
R0845:Serinc1 UTSW 10 57,401,479 (GRCm39) missense probably benign 0.39
R1912:Serinc1 UTSW 10 57,401,547 (GRCm39) missense probably benign 0.05
R1913:Serinc1 UTSW 10 57,395,561 (GRCm39) missense probably benign 0.01
R4820:Serinc1 UTSW 10 57,401,466 (GRCm39) missense possibly damaging 0.89
R4947:Serinc1 UTSW 10 57,399,141 (GRCm39) missense probably damaging 0.99
R5299:Serinc1 UTSW 10 57,399,147 (GRCm39) missense probably damaging 0.99
R5562:Serinc1 UTSW 10 57,400,147 (GRCm39) nonsense probably null
R5589:Serinc1 UTSW 10 57,399,262 (GRCm39) missense probably benign 0.01
R7723:Serinc1 UTSW 10 57,403,918 (GRCm39) missense probably benign 0.08
R8742:Serinc1 UTSW 10 57,395,895 (GRCm39) missense probably benign 0.31
R8885:Serinc1 UTSW 10 57,395,864 (GRCm39) missense probably benign 0.00
R8912:Serinc1 UTSW 10 57,400,075 (GRCm39) missense probably benign 0.10
R9126:Serinc1 UTSW 10 57,395,577 (GRCm39) missense probably benign
Z1177:Serinc1 UTSW 10 57,399,106 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCAAAGGATGACTGCTTTCG -3'
(R):5'- CCGTCTTTACAGTAGCCTACATG -3'

Sequencing Primer
(F):5'- AAGGAGTTCCAGGTAGCA -3'
(R):5'- TAAGTGGTTCCTCAGAGC -3'
Posted On 2019-06-26