Incidental Mutation 'R7182:Gabrg2'
ID559058
Institutional Source Beutler Lab
Gene Symbol Gabrg2
Ensembl Gene ENSMUSG00000020436
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 2
Synonymsgamma2, Gabrg-2, GABAA-R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7182 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location41910203-42000857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41920506 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 271 (M271V)
Ref Sequence ENSEMBL: ENSMUSP00000063812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070725] [ENSMUST00000070735] [ENSMUST00000109290]
Predicted Effect probably damaging
Transcript: ENSMUST00000070725
AA Change: M271V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064739
Gene: ENSMUSG00000020436
AA Change: M271V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.7e-55 PFAM
Pfam:Neur_chan_memb 278 408 1.8e-46 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070735
AA Change: M271V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063812
Gene: ENSMUSG00000020436
AA Change: M271V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.9e-53 PFAM
Pfam:Neur_chan_memb 278 419 2.2e-38 PFAM
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109290
AA Change: M271V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104913
Gene: ENSMUSG00000020436
AA Change: M271V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 1.2e-55 PFAM
Pfam:Neur_chan_memb 278 381 4.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: This gene encodes a gamma-aminobutyric acid (GABA)-A receptor subunit, which is a member of the ligand-gated ion channel family. GABA is the major inhibitory neurotransmitter in the adult central nervous system, and conversely exhibits an excitatory function during development. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. This gene encodes one of three gamma subunits in mammals, which contain the binding site for benzodiazepine drugs. Several mutations in this gene are associated with epileptic seizures, and genetic knockdown is associated with anxiety behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded postnatal growth, impaired sensorimotor function, and greatly reduced lifespan. Heterozygotes show enhanced anxiety-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Gabrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Gabrg2 APN 11 41971772 missense possibly damaging 0.87
IGL00787:Gabrg2 APN 11 41912522 missense probably benign 0.00
IGL01941:Gabrg2 APN 11 41971721 missense probably damaging 1.00
IGL02801:Gabrg2 APN 11 41912393 missense probably damaging 1.00
R0376:Gabrg2 UTSW 11 41916315 missense possibly damaging 0.92
R1607:Gabrg2 UTSW 11 41976663 missense probably damaging 0.98
R1934:Gabrg2 UTSW 11 41920470 missense probably benign 0.10
R2226:Gabrg2 UTSW 11 41971908 missense probably damaging 1.00
R2281:Gabrg2 UTSW 11 41976636 missense possibly damaging 0.72
R4013:Gabrg2 UTSW 11 41971880 missense possibly damaging 0.83
R4675:Gabrg2 UTSW 11 41968823 missense probably damaging 1.00
R4869:Gabrg2 UTSW 11 41920404 missense probably damaging 1.00
R5282:Gabrg2 UTSW 11 41971732 missense probably damaging 1.00
R5316:Gabrg2 UTSW 11 41976558 missense probably damaging 1.00
R5729:Gabrg2 UTSW 11 41967623 missense probably damaging 1.00
R5876:Gabrg2 UTSW 11 41968820 missense probably damaging 1.00
R6279:Gabrg2 UTSW 11 42000523 splice site probably null
R6300:Gabrg2 UTSW 11 42000523 splice site probably null
R6315:Gabrg2 UTSW 11 41971861 missense probably damaging 0.99
R7181:Gabrg2 UTSW 11 41920434 missense probably damaging 1.00
R7368:Gabrg2 UTSW 11 41976563 nonsense probably null
R7568:Gabrg2 UTSW 11 41916292 missense probably benign 0.05
R7599:Gabrg2 UTSW 11 41967624 missense possibly damaging 0.79
R7901:Gabrg2 UTSW 11 41976591 missense probably benign 0.00
R7940:Gabrg2 UTSW 11 41967647 missense probably benign 0.06
R8250:Gabrg2 UTSW 11 41967552 missense probably benign 0.00
X0065:Gabrg2 UTSW 11 41912369 missense probably damaging 1.00
Z1191:Gabrg2 UTSW 11 41916277 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTTGAATTCAGGGCAAAC -3'
(R):5'- AACATTCCCGTAGCTCAGTCC -3'

Sequencing Primer
(F):5'- TTCTGGCAGGAACAGCAT -3'
(R):5'- AGTCCTTCTCTTTCAGGTGACTATG -3'
Posted On2019-06-26