Incidental Mutation 'R7182:Cep112'
ID 559064
Institutional Source Beutler Lab
Gene Symbol Cep112
Ensembl Gene ENSMUSG00000020728
Gene Name centrosomal protein 112
Synonyms Macoco, Ccdc46, 8430407H02Rik, 1700029K01Rik, 1700001M19Rik
MMRRC Submission 045234-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.590) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 108316041-108751441 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 108573670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 6 (D6A)
Ref Sequence ENSEMBL: ENSMUSP00000102326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061287] [ENSMUST00000106715] [ENSMUST00000106718] [ENSMUST00000106724] [ENSMUST00000130515] [ENSMUST00000133670] [ENSMUST00000146912] [ENSMUST00000150863] [ENSMUST00000182729]
AlphaFold Q5PR68
Predicted Effect probably benign
Transcript: ENSMUST00000061287
SMART Domains Protein: ENSMUSP00000050597
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
Pfam:DUF4485 13 98 4.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106715
AA Change: D6A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102326
Gene: ENSMUSG00000020728
AA Change: D6A

DomainStartEndE-ValueType
coiled coil region 11 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106718
AA Change: D6A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102329
Gene: ENSMUSG00000020728
AA Change: D6A

DomainStartEndE-ValueType
coiled coil region 26 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106724
AA Change: D6A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102335
Gene: ENSMUSG00000020728
AA Change: D6A

DomainStartEndE-ValueType
coiled coil region 64 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130515
SMART Domains Protein: ENSMUSP00000114569
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133670
SMART Domains Protein: ENSMUSP00000114627
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
internal_repeat_2 66 104 4.9e-5 PROSPERO
internal_repeat_1 81 110 2.63e-5 PROSPERO
coiled coil region 123 203 N/A INTRINSIC
internal_repeat_3 252 264 4.9e-5 PROSPERO
low complexity region 317 328 N/A INTRINSIC
internal_repeat_2 332 370 4.9e-5 PROSPERO
internal_repeat_3 532 544 4.9e-5 PROSPERO
internal_repeat_1 540 569 2.63e-5 PROSPERO
coiled coil region 571 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146912
SMART Domains Protein: ENSMUSP00000120601
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
coiled coil region 25 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150863
SMART Domains Protein: ENSMUSP00000122509
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.8e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182729
SMART Domains Protein: ENSMUSP00000138235
Gene: ENSMUSG00000020728

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.4e-31 PFAM
coiled coil region 233 299 N/A INTRINSIC
coiled coil region 355 435 N/A INTRINSIC
coiled coil region 462 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein that belongs to the cell division control protein 42 effector protein family. In neurons, it localizes to the cytoplasm of dendrites and is also enriched in the nucleus where it interacts with the RNA polymerase III transcriptional repressor Maf1 to regulate gamma-aminobutyric acid A receptor surface expression. In addition, the protein has been identified as a component of the human centrosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,578 (GRCm39) V323A unknown Het
AC117241.1 A G 17: 7,620,087 (GRCm39) V158A unknown Het
Acadm A G 3: 153,647,518 (GRCm39) probably null Het
Adcy10 T G 1: 165,371,039 (GRCm39) probably null Het
Aldh6a1 C T 12: 84,488,605 (GRCm39) A94T probably benign Het
Ano2 T A 6: 125,767,256 (GRCm39) L229Q probably damaging Het
Cacna1h C T 17: 25,596,629 (GRCm39) R1828H probably damaging Het
Ccdc33 A T 9: 57,941,456 (GRCm39) probably null Het
Chd9 T C 8: 91,733,250 (GRCm39) F1373S unknown Het
Cog5 T C 12: 31,735,707 (GRCm39) L158P probably damaging Het
Col6a3 G A 1: 90,731,400 (GRCm39) Q1618* probably null Het
Dlg5 A G 14: 24,294,924 (GRCm39) V3A Het
Dnah7a T A 1: 53,659,620 (GRCm39) probably null Het
Dpp10 A T 1: 123,268,880 (GRCm39) H716Q probably benign Het
Epor A G 9: 21,874,625 (GRCm39) F35L probably benign Het
Ergic1 A T 17: 26,873,856 (GRCm39) Y92F Het
Fam98a G A 17: 75,846,013 (GRCm39) Q273* probably null Het
Fhdc1 G A 3: 84,356,157 (GRCm39) T429I probably damaging Het
Fmnl2 T A 2: 52,997,453 (GRCm39) L468Q unknown Het
Fmnl3 C T 15: 99,219,663 (GRCm39) R695Q probably damaging Het
Gabrg2 T C 11: 41,811,333 (GRCm39) M271V probably damaging Het
Garin4 C T 1: 190,895,548 (GRCm39) R365H probably damaging Het
Gk5 G T 9: 96,001,579 (GRCm39) V26L possibly damaging Het
Gm14412 A C 2: 177,007,408 (GRCm39) N162K probably benign Het
Gm3604 T C 13: 62,519,689 (GRCm39) D22G probably damaging Het
Gm5565 G T 5: 146,094,865 (GRCm39) H294N probably benign Het
Hsf2 T A 10: 57,381,272 (GRCm39) D287E possibly damaging Het
Ift70b A T 2: 75,768,293 (GRCm39) Y153* probably null Het
Impdh2 G A 9: 108,440,407 (GRCm39) R231H possibly damaging Het
Irak3 T C 10: 120,002,416 (GRCm39) H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,648,765 (GRCm39) probably null Het
Lrch3 T A 16: 32,814,149 (GRCm39) D551E probably benign Het
Manba A T 3: 135,273,274 (GRCm39) N736I probably benign Het
Map2 A G 1: 66,451,812 (GRCm39) D234G possibly damaging Het
Mdk C A 2: 91,761,197 (GRCm39) K121N unknown Het
Mfn1 T A 3: 32,618,369 (GRCm39) L526Q probably damaging Het
Mfsd2b A G 12: 4,916,157 (GRCm39) probably null Het
Mnat1 G T 12: 73,277,452 (GRCm39) E233* probably null Het
Mtmr4 T C 11: 87,495,431 (GRCm39) probably null Het
Mtrf1 A G 14: 79,660,904 (GRCm39) E432G possibly damaging Het
Muc5b C T 7: 141,396,382 (GRCm39) R165C unknown Het
Naip6 T A 13: 100,452,657 (GRCm39) I135F probably benign Het
Nod2 A G 8: 89,390,460 (GRCm39) T256A probably benign Het
Notch4 T A 17: 34,802,473 (GRCm39) V1298E probably damaging Het
Nudc G T 4: 133,261,776 (GRCm39) D169E possibly damaging Het
Obscn A T 11: 58,925,927 (GRCm39) I5602N probably damaging Het
Or5b114-ps1 G A 19: 13,353,208 (GRCm39) G294E unknown Het
Osbpl10 G A 9: 114,896,319 (GRCm39) D18N probably damaging Het
Pigk G A 3: 152,428,188 (GRCm39) V72I possibly damaging Het
Prl8a6 C T 13: 27,621,153 (GRCm39) E26K probably damaging Het
Prpf8 A G 11: 75,381,553 (GRCm39) Y318C possibly damaging Het
Rab13 A G 3: 90,132,070 (GRCm39) D159G possibly damaging Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ryr2 T C 13: 11,774,643 (GRCm39) H1171R probably benign Het
Scn4a T A 11: 106,221,134 (GRCm39) I842F probably benign Het
Scnm1 A T 3: 95,041,165 (GRCm39) N14K possibly damaging Het
Serinc1 A T 10: 57,400,457 (GRCm39) I137N probably benign Het
Slc30a3 T C 5: 31,244,169 (GRCm39) Q371R probably benign Het
Slc30a3 A C 5: 31,247,014 (GRCm39) M103R probably damaging Het
Slco1a1 A T 6: 141,857,565 (GRCm39) C589S probably damaging Het
Slco1b2 A G 6: 141,602,656 (GRCm39) Y203C probably damaging Het
Spty2d1 A T 7: 46,648,271 (GRCm39) D219E probably benign Het
Svep1 A T 4: 58,043,991 (GRCm39) S3552T probably benign Het
Tmem62 A G 2: 120,835,224 (GRCm39) I516M probably benign Het
Trim61 A T 8: 65,466,266 (GRCm39) S332T probably damaging Het
Trmt10b A C 4: 45,308,520 (GRCm39) T227P probably benign Het
Trpc3 T C 3: 36,709,258 (GRCm39) Q406R probably benign Het
Ush2a A T 1: 188,485,740 (GRCm39) Y2950F probably benign Het
Usp32 C T 11: 84,930,996 (GRCm39) G478D probably benign Het
Wdfy3 A G 5: 102,091,758 (GRCm39) L527P possibly damaging Het
Wdr73 A G 7: 80,543,426 (GRCm39) V163A possibly damaging Het
Other mutations in Cep112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Cep112 APN 11 108,481,879 (GRCm39) missense probably damaging 1.00
IGL00705:Cep112 APN 11 108,362,859 (GRCm39) missense probably benign
IGL00848:Cep112 APN 11 108,362,886 (GRCm39) missense probably damaging 1.00
IGL00975:Cep112 APN 11 108,325,012 (GRCm39) missense probably damaging 1.00
IGL01085:Cep112 APN 11 108,377,432 (GRCm39) missense probably damaging 1.00
IGL01286:Cep112 APN 11 108,750,235 (GRCm39) critical splice donor site probably null
IGL01536:Cep112 APN 11 108,422,237 (GRCm39) missense probably null 0.08
IGL02622:Cep112 APN 11 108,409,509 (GRCm39) missense probably benign 0.26
IGL02720:Cep112 APN 11 108,750,177 (GRCm39) missense probably damaging 0.98
FR4976:Cep112 UTSW 11 108,316,178 (GRCm39) unclassified probably benign
PIT4466001:Cep112 UTSW 11 108,410,722 (GRCm39) missense probably benign
R0727:Cep112 UTSW 11 108,397,380 (GRCm39) missense probably damaging 1.00
R0907:Cep112 UTSW 11 108,461,258 (GRCm39) splice site probably benign
R0908:Cep112 UTSW 11 108,555,323 (GRCm39) missense possibly damaging 0.69
R1236:Cep112 UTSW 11 108,750,200 (GRCm39) missense probably damaging 1.00
R1514:Cep112 UTSW 11 108,362,880 (GRCm39) missense probably damaging 1.00
R2049:Cep112 UTSW 11 108,497,151 (GRCm39) missense probably damaging 0.96
R2058:Cep112 UTSW 11 108,410,087 (GRCm39) critical splice donor site probably null
R2059:Cep112 UTSW 11 108,410,087 (GRCm39) critical splice donor site probably null
R2126:Cep112 UTSW 11 108,399,084 (GRCm39) missense probably damaging 0.98
R2142:Cep112 UTSW 11 108,497,151 (GRCm39) missense probably damaging 0.96
R2196:Cep112 UTSW 11 108,461,187 (GRCm39) missense probably damaging 0.98
R2276:Cep112 UTSW 11 108,746,671 (GRCm39) missense probably damaging 1.00
R2414:Cep112 UTSW 11 108,643,408 (GRCm39) missense possibly damaging 0.91
R2655:Cep112 UTSW 11 108,328,027 (GRCm39) splice site probably benign
R2882:Cep112 UTSW 11 108,410,038 (GRCm39) missense possibly damaging 0.94
R3001:Cep112 UTSW 11 108,331,329 (GRCm39) missense probably damaging 1.00
R3002:Cep112 UTSW 11 108,331,329 (GRCm39) missense probably damaging 1.00
R3003:Cep112 UTSW 11 108,331,329 (GRCm39) missense probably damaging 1.00
R4407:Cep112 UTSW 11 108,410,027 (GRCm39) missense possibly damaging 0.93
R4796:Cep112 UTSW 11 108,377,818 (GRCm39) critical splice donor site probably null
R4898:Cep112 UTSW 11 108,397,471 (GRCm39) missense probably damaging 0.96
R4899:Cep112 UTSW 11 108,497,110 (GRCm39) missense probably damaging 0.96
R4977:Cep112 UTSW 11 108,325,062 (GRCm39) missense probably damaging 0.97
R5021:Cep112 UTSW 11 108,361,154 (GRCm39) missense possibly damaging 0.86
R5186:Cep112 UTSW 11 108,643,386 (GRCm39) missense probably benign 0.00
R5462:Cep112 UTSW 11 108,409,570 (GRCm39) missense probably damaging 1.00
R5494:Cep112 UTSW 11 108,555,431 (GRCm39) missense probably damaging 1.00
R5506:Cep112 UTSW 11 108,555,429 (GRCm39) missense probably damaging 1.00
R5560:Cep112 UTSW 11 108,328,061 (GRCm39) missense probably damaging 1.00
R5682:Cep112 UTSW 11 108,361,138 (GRCm39) missense probably damaging 1.00
R5857:Cep112 UTSW 11 108,422,297 (GRCm39) splice site probably benign
R5863:Cep112 UTSW 11 108,497,058 (GRCm39) missense probably damaging 1.00
R5884:Cep112 UTSW 11 108,461,142 (GRCm39) missense probably damaging 0.99
R5913:Cep112 UTSW 11 108,648,514 (GRCm39) missense probably damaging 0.99
R6344:Cep112 UTSW 11 108,410,000 (GRCm39) missense probably damaging 0.98
R6498:Cep112 UTSW 11 108,331,357 (GRCm39) missense probably benign 0.25
R6611:Cep112 UTSW 11 108,397,377 (GRCm39) missense possibly damaging 0.71
R6638:Cep112 UTSW 11 108,746,696 (GRCm39) missense probably damaging 1.00
R6916:Cep112 UTSW 11 108,750,202 (GRCm39) missense probably damaging 1.00
R7262:Cep112 UTSW 11 108,555,467 (GRCm39) missense probably damaging 0.99
R7386:Cep112 UTSW 11 108,699,507 (GRCm39) missense probably benign 0.00
R7539:Cep112 UTSW 11 108,746,654 (GRCm39) missense probably benign 0.38
R8262:Cep112 UTSW 11 108,393,977 (GRCm39) missense probably damaging 1.00
R8681:Cep112 UTSW 11 108,316,478 (GRCm39) critical splice donor site probably null
R8845:Cep112 UTSW 11 108,461,193 (GRCm39) missense probably damaging 1.00
R8955:Cep112 UTSW 11 108,643,260 (GRCm39) missense possibly damaging 0.61
R9213:Cep112 UTSW 11 108,377,779 (GRCm39) missense probably benign
R9348:Cep112 UTSW 11 108,328,076 (GRCm39) missense probably damaging 0.97
R9516:Cep112 UTSW 11 108,648,514 (GRCm39) missense probably damaging 0.99
R9771:Cep112 UTSW 11 108,573,517 (GRCm39) intron probably benign
R9784:Cep112 UTSW 11 108,461,217 (GRCm39) missense probably damaging 1.00
Z1176:Cep112 UTSW 11 108,316,136 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTCCCGTAAGCTTATG -3'
(R):5'- AGATGTTTCCAAGGCAATTTAGTCC -3'

Sequencing Primer
(F):5'- CCCGTAAGCTTATGGTGTTGCC -3'
(R):5'- GGTTGTTTCTAATACTAAGCCTTCC -3'
Posted On 2019-06-26