Incidental Mutation 'R7182:Aldh6a1'
ID 559068
Institutional Source Beutler Lab
Gene Symbol Aldh6a1
Ensembl Gene ENSMUSG00000021238
Gene Name aldehyde dehydrogenase family 6, subfamily A1
Synonyms Mmsdh, 1110038I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 84430717-84451004 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84441831 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 94 (A94T)
Ref Sequence ENSEMBL: ENSMUSP00000082288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085192] [ENSMUST00000220491]
AlphaFold Q9EQ20
Predicted Effect probably benign
Transcript: ENSMUST00000085192
AA Change: A94T

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000082288
Gene: ENSMUSG00000021238
AA Change: A94T

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:Aldedh 48 512 1.9e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220491
AA Change: A69T

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000221969
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: This gene encodes a member of the aldehyde dehydrogenase protein family. The encoded enzyme is a mitochondrial methylmalonate semialdehyde dehydrogenase that plays a role in the valine and pyrimidine catabolic pathways. This enzyme catalyzes the irreversible oxidative decarboxylation of malonate and methylmalonate semialdehydes to acetyl- and propionyl-CoA. Mutations in the human gene result in Methylmalonate Semialdehyde Dehydrogenase Deficiency, characterized by elevated beta-alanine, 3-hydroxypropionic acid, and both isomers of 3-amino and 3-hydroxyisobutyric acids in urine organic acids. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Aldh6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Aldh6a1 APN 12 84439538 missense probably damaging 1.00
IGL02213:Aldh6a1 APN 12 84432552 intron probably benign
IGL02489:Aldh6a1 APN 12 84433972 missense possibly damaging 0.66
IGL02806:Aldh6a1 APN 12 84439640 missense probably damaging 1.00
IGL02930:Aldh6a1 APN 12 84433982 missense possibly damaging 0.78
IGL03183:Aldh6a1 APN 12 84436440 splice site probably null
PIT4378001:Aldh6a1 UTSW 12 84441872 missense probably benign 0.01
R0015:Aldh6a1 UTSW 12 84441780 missense probably damaging 1.00
R0506:Aldh6a1 UTSW 12 84433526 missense probably damaging 1.00
R1458:Aldh6a1 UTSW 12 84439663 missense probably null 0.01
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1579:Aldh6a1 UTSW 12 84441848 missense possibly damaging 0.83
R2300:Aldh6a1 UTSW 12 84439529 missense probably damaging 1.00
R4351:Aldh6a1 UTSW 12 84443761 missense probably benign 0.00
R4447:Aldh6a1 UTSW 12 84439709 missense possibly damaging 0.73
R5205:Aldh6a1 UTSW 12 84439644 missense probably damaging 1.00
R5242:Aldh6a1 UTSW 12 84436383 missense probably damaging 1.00
R5443:Aldh6a1 UTSW 12 84437971 splice site probably null
R6849:Aldh6a1 UTSW 12 84443787 missense probably benign 0.00
R7001:Aldh6a1 UTSW 12 84441888 missense probably damaging 1.00
R7417:Aldh6a1 UTSW 12 84441782 missense probably benign 0.01
R7492:Aldh6a1 UTSW 12 84436866 missense probably damaging 1.00
R7749:Aldh6a1 UTSW 12 84442081 missense probably benign 0.00
R8511:Aldh6a1 UTSW 12 84433971 missense possibly damaging 0.93
R9572:Aldh6a1 UTSW 12 84440243 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATGTCCTTCTACGTTGTAGAG -3'
(R):5'- TGGGGACTTAAACCTGCTAACC -3'

Sequencing Primer
(F):5'- CTACGTTGTAGAGTTAGTGAGGACAG -3'
(R):5'- CCTGCTAACCTAGAATTTTGGGAGC -3'
Posted On 2019-06-26