Incidental Mutation 'R7182:Prl8a6'
ID 559070
Institutional Source Beutler Lab
Gene Symbol Prl8a6
Ensembl Gene ENSMUSG00000021345
Gene Name prolactin family 8, subfamily a, member 6
Synonyms Prlpc, PLP-Ca, PLP-calpha, Prlpc1
MMRRC Submission 045234-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 27616664-27622671 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27621153 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 26 (E26K)
Ref Sequence ENSEMBL: ENSMUSP00000105984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018392] [ENSMUST00000080762] [ENSMUST00000110355]
AlphaFold Q9DAY2
Predicted Effect probably damaging
Transcript: ENSMUST00000018392
AA Change: E25K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018392
Gene: ENSMUSG00000021345
AA Change: E25K

DomainStartEndE-ValueType
Pfam:Hormone_1 16 239 2.8e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080762
AA Change: E26K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079584
Gene: ENSMUSG00000021345
AA Change: E26K

DomainStartEndE-ValueType
Pfam:Hormone_1 17 86 1.9e-13 PFAM
Pfam:Hormone_1 83 205 2.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110355
AA Change: E26K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105984
Gene: ENSMUSG00000021345
AA Change: E26K

DomainStartEndE-ValueType
Pfam:Hormone_1 17 240 1e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,578 (GRCm39) V323A unknown Het
AC117241.1 A G 17: 7,620,087 (GRCm39) V158A unknown Het
Acadm A G 3: 153,647,518 (GRCm39) probably null Het
Adcy10 T G 1: 165,371,039 (GRCm39) probably null Het
Aldh6a1 C T 12: 84,488,605 (GRCm39) A94T probably benign Het
Ano2 T A 6: 125,767,256 (GRCm39) L229Q probably damaging Het
Cacna1h C T 17: 25,596,629 (GRCm39) R1828H probably damaging Het
Ccdc33 A T 9: 57,941,456 (GRCm39) probably null Het
Cep112 A C 11: 108,573,670 (GRCm39) D6A probably benign Het
Chd9 T C 8: 91,733,250 (GRCm39) F1373S unknown Het
Cog5 T C 12: 31,735,707 (GRCm39) L158P probably damaging Het
Col6a3 G A 1: 90,731,400 (GRCm39) Q1618* probably null Het
Dlg5 A G 14: 24,294,924 (GRCm39) V3A Het
Dnah7a T A 1: 53,659,620 (GRCm39) probably null Het
Dpp10 A T 1: 123,268,880 (GRCm39) H716Q probably benign Het
Epor A G 9: 21,874,625 (GRCm39) F35L probably benign Het
Ergic1 A T 17: 26,873,856 (GRCm39) Y92F Het
Fam98a G A 17: 75,846,013 (GRCm39) Q273* probably null Het
Fhdc1 G A 3: 84,356,157 (GRCm39) T429I probably damaging Het
Fmnl2 T A 2: 52,997,453 (GRCm39) L468Q unknown Het
Fmnl3 C T 15: 99,219,663 (GRCm39) R695Q probably damaging Het
Gabrg2 T C 11: 41,811,333 (GRCm39) M271V probably damaging Het
Garin4 C T 1: 190,895,548 (GRCm39) R365H probably damaging Het
Gk5 G T 9: 96,001,579 (GRCm39) V26L possibly damaging Het
Gm14412 A C 2: 177,007,408 (GRCm39) N162K probably benign Het
Gm3604 T C 13: 62,519,689 (GRCm39) D22G probably damaging Het
Gm5565 G T 5: 146,094,865 (GRCm39) H294N probably benign Het
Hsf2 T A 10: 57,381,272 (GRCm39) D287E possibly damaging Het
Ift70b A T 2: 75,768,293 (GRCm39) Y153* probably null Het
Impdh2 G A 9: 108,440,407 (GRCm39) R231H possibly damaging Het
Irak3 T C 10: 120,002,416 (GRCm39) H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,648,765 (GRCm39) probably null Het
Lrch3 T A 16: 32,814,149 (GRCm39) D551E probably benign Het
Manba A T 3: 135,273,274 (GRCm39) N736I probably benign Het
Map2 A G 1: 66,451,812 (GRCm39) D234G possibly damaging Het
Mdk C A 2: 91,761,197 (GRCm39) K121N unknown Het
Mfn1 T A 3: 32,618,369 (GRCm39) L526Q probably damaging Het
Mfsd2b A G 12: 4,916,157 (GRCm39) probably null Het
Mnat1 G T 12: 73,277,452 (GRCm39) E233* probably null Het
Mtmr4 T C 11: 87,495,431 (GRCm39) probably null Het
Mtrf1 A G 14: 79,660,904 (GRCm39) E432G possibly damaging Het
Muc5b C T 7: 141,396,382 (GRCm39) R165C unknown Het
Naip6 T A 13: 100,452,657 (GRCm39) I135F probably benign Het
Nod2 A G 8: 89,390,460 (GRCm39) T256A probably benign Het
Notch4 T A 17: 34,802,473 (GRCm39) V1298E probably damaging Het
Nudc G T 4: 133,261,776 (GRCm39) D169E possibly damaging Het
Obscn A T 11: 58,925,927 (GRCm39) I5602N probably damaging Het
Or5b114-ps1 G A 19: 13,353,208 (GRCm39) G294E unknown Het
Osbpl10 G A 9: 114,896,319 (GRCm39) D18N probably damaging Het
Pigk G A 3: 152,428,188 (GRCm39) V72I possibly damaging Het
Prpf8 A G 11: 75,381,553 (GRCm39) Y318C possibly damaging Het
Rab13 A G 3: 90,132,070 (GRCm39) D159G possibly damaging Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ryr2 T C 13: 11,774,643 (GRCm39) H1171R probably benign Het
Scn4a T A 11: 106,221,134 (GRCm39) I842F probably benign Het
Scnm1 A T 3: 95,041,165 (GRCm39) N14K possibly damaging Het
Serinc1 A T 10: 57,400,457 (GRCm39) I137N probably benign Het
Slc30a3 T C 5: 31,244,169 (GRCm39) Q371R probably benign Het
Slc30a3 A C 5: 31,247,014 (GRCm39) M103R probably damaging Het
Slco1a1 A T 6: 141,857,565 (GRCm39) C589S probably damaging Het
Slco1b2 A G 6: 141,602,656 (GRCm39) Y203C probably damaging Het
Spty2d1 A T 7: 46,648,271 (GRCm39) D219E probably benign Het
Svep1 A T 4: 58,043,991 (GRCm39) S3552T probably benign Het
Tmem62 A G 2: 120,835,224 (GRCm39) I516M probably benign Het
Trim61 A T 8: 65,466,266 (GRCm39) S332T probably damaging Het
Trmt10b A C 4: 45,308,520 (GRCm39) T227P probably benign Het
Trpc3 T C 3: 36,709,258 (GRCm39) Q406R probably benign Het
Ush2a A T 1: 188,485,740 (GRCm39) Y2950F probably benign Het
Usp32 C T 11: 84,930,996 (GRCm39) G478D probably benign Het
Wdfy3 A G 5: 102,091,758 (GRCm39) L527P possibly damaging Het
Wdr73 A G 7: 80,543,426 (GRCm39) V163A possibly damaging Het
Other mutations in Prl8a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0157:Prl8a6 UTSW 13 27,620,162 (GRCm39) splice site probably benign
R0115:Prl8a6 UTSW 13 27,617,084 (GRCm39) missense probably benign 0.07
R0481:Prl8a6 UTSW 13 27,617,084 (GRCm39) missense probably benign 0.07
R0514:Prl8a6 UTSW 13 27,616,990 (GRCm39) nonsense probably null
R2209:Prl8a6 UTSW 13 27,619,369 (GRCm39) missense probably benign 0.03
R2329:Prl8a6 UTSW 13 27,621,050 (GRCm39) missense probably benign
R3876:Prl8a6 UTSW 13 27,617,015 (GRCm39) nonsense probably null
R5259:Prl8a6 UTSW 13 27,620,179 (GRCm39) nonsense probably null
R5800:Prl8a6 UTSW 13 27,619,453 (GRCm39) missense probably benign
R5921:Prl8a6 UTSW 13 27,621,171 (GRCm39) missense probably damaging 1.00
R6901:Prl8a6 UTSW 13 27,621,030 (GRCm39) missense possibly damaging 0.87
R7230:Prl8a6 UTSW 13 27,617,021 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGTTCAAGTATTAGTATGGAGG -3'
(R):5'- ATTCAATTACTTGCCTCAGTGC -3'

Sequencing Primer
(F):5'- GAGGTTGAGGTACTTACAAGTTCTAC -3'
(R):5'- AATTACTTGCCTCAGTGCTTAGTG -3'
Posted On 2019-06-26