Mutagenetix > Incidental Mutations

Incidental Mutation 'R7182:Mtrf1'

559074

Institutional Source

Beutler Lab

Gene Symbol

Mtrf1

Ensembl Gene

ENSMUSG00000022022

Gene Name

mitochondrial translational release factor 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R7182 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79397772-79423587 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79423464 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 432 (E432G)

Ref Sequence

ENSEMBL: ENSMUSP00000022600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022600] [ENSMUST00000061222]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022600
AA Change: E432G

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022
AA Change: E432G

Domain	Start	End	E-Value	Type
low complexity region	104	119	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
PCRF	139	255	5.96e-27	SMART
Pfam:RF-1	290	400	2.6e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061222

SMART Domains

Protein: ENSMUSP00000060768
Gene: ENSMUSG00000043881

Domain	Start	End	E-Value	Type
Blast:BTB	11	44	2e-11	BLAST
BTB	63	168	1.05e-23	SMART
BACK	173	279	1.41e-19	SMART
low complexity region	317	340	N/A	INTRINSIC
Pfam:Kelch_1	434	481	1.7e-9	PFAM
low complexity region	657	676	N/A	INTRINSIC

Meta Mutation Damage Score

0.5604

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,849,714	V323A	unknown	Het
AC117241.1	A	G	17: 7,352,688	V158A	unknown	Het
Acadm	A	G	3: 153,941,881		probably null	Het
Adcy10	T	G	1: 165,543,470		probably null	Het
Aldh6a1	C	T	12: 84,441,831	A94T	probably benign	Het
Ano2	T	A	6: 125,790,293	L229Q	probably damaging	Het
Cacna1h	C	T	17: 25,377,655	R1828H	probably damaging	Het
Ccdc33	A	T	9: 58,034,173		probably null	Het
Cep112	A	C	11: 108,682,844	D6A	probably benign	Het
Chd9	T	C	8: 91,006,622	F1373S	unknown	Het
Cog5	T	C	12: 31,685,708	L158P	probably damaging	Het
Col6a3	G	A	1: 90,803,678	Q1618*	probably null	Het
Dlg5	A	G	14: 24,244,856	V3A		Het
Dnah7a	T	A	1: 53,620,461		probably null	Het
Dpp10	A	T	1: 123,341,151	H716Q	probably benign	Het
Epor	A	G	9: 21,963,329	F35L	probably benign	Het
Ergic1	A	T	17: 26,654,882	Y92F		Het
Fam71a	C	T	1: 191,163,351	R365H	probably damaging	Het
Fam98a	G	A	17: 75,539,018	Q273*	probably null	Het
Fhdc1	G	A	3: 84,448,850	T429I	probably damaging	Het
Fmnl2	T	A	2: 53,107,441	L468Q	unknown	Het
Fmnl3	C	T	15: 99,321,782	R695Q	probably damaging	Het
Gabrg2	T	C	11: 41,920,506	M271V	probably damaging	Het
Gk5	G	T	9: 96,119,526	V26L	possibly damaging	Het
Gm14412	A	C	2: 177,315,615	N162K	probably benign	Het
Gm3604	T	C	13: 62,371,875	D22G	probably damaging	Het
Gm5565	G	T	5: 146,158,055	H294N	probably benign	Het
Hsf2	T	A	10: 57,505,176	D287E	possibly damaging	Het
Impdh2	G	A	9: 108,563,208	R231H	possibly damaging	Het
Irak3	T	C	10: 120,166,511	H234R	probably damaging	Het
Lrba	GTTCCCTTC	GTTC	3: 86,741,458		probably null	Het
Lrch3	T	A	16: 32,993,779	D551E	probably benign	Het
Manba	A	T	3: 135,567,513	N736I	probably benign	Het
Map2	A	G	1: 66,412,653	D234G	possibly damaging	Het
Mdk	C	A	2: 91,930,852	K121N	unknown	Het
Mfn1	T	A	3: 32,564,220	L526Q	probably damaging	Het
Mfsd2b	A	G	12: 4,866,157		probably null	Het
Mnat1	G	T	12: 73,230,678	E233*	probably null	Het
Mtmr4	T	C	11: 87,604,605		probably null	Het
Muc5b	C	T	7: 141,842,645	R165C	unknown	Het
Naip6	T	A	13: 100,316,149	I135F	probably benign	Het
Nod2	A	G	8: 88,663,832	T256A	probably benign	Het
Notch4	T	A	17: 34,583,499	V1298E	probably damaging	Het
Nudc	G	T	4: 133,534,465	D169E	possibly damaging	Het
Obscn	A	T	11: 59,035,101	I5602N	probably damaging	Het
Olfr1468-ps1	G	A	19: 13,375,844	G294E	unknown	Het
Osbpl10	G	A	9: 115,067,251	D18N	probably damaging	Het
Pigk	G	A	3: 152,722,551	V72I	possibly damaging	Het
Prl8a6	C	T	13: 27,437,170	E26K	probably damaging	Het
Prpf8	A	G	11: 75,490,727	Y318C	possibly damaging	Het
Rab13	A	G	3: 90,224,763	D159G	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Ryr2	T	C	13: 11,759,757	H1171R	probably benign	Het
Scn4a	T	A	11: 106,330,308	I842F	probably benign	Het
Scnm1	A	T	3: 95,133,854	N14K	possibly damaging	Het
Serinc1	A	T	10: 57,524,361	I137N	probably benign	Het
Slc30a3	T	C	5: 31,086,825	Q371R	probably benign	Het
Slc30a3	A	C	5: 31,089,670	M103R	probably damaging	Het
Slco1a1	A	T	6: 141,911,839	C589S	probably damaging	Het
Slco1b2	A	G	6: 141,656,930	Y203C	probably damaging	Het
Spty2d1	A	T	7: 46,998,523	D219E	probably benign	Het
Svep1	A	T	4: 58,043,991	S3552T	probably benign	Het
Tmem62	A	G	2: 121,004,743	I516M	probably benign	Het
Trim61	A	T	8: 65,013,614	S332T	probably damaging	Het
Trmt10b	A	C	4: 45,308,520	T227P	probably benign	Het
Trpc3	T	C	3: 36,655,109	Q406R	probably benign	Het
Ttc30b	A	T	2: 75,937,949	Y153*	probably null	Het
Ush2a	A	T	1: 188,753,543	Y2950F	probably benign	Het
Usp32	C	T	11: 85,040,170	G478D	probably benign	Het
Wdfy3	A	G	5: 101,943,892	L527P	possibly damaging	Het
Wdr73	A	G	7: 80,893,678	V163A	possibly damaging	Het

Other mutations in Mtrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01356:Mtrf1	APN	14	79423425	missense	probably benign	0.10
IGL01478:Mtrf1	APN	14	79402920	splice site	probably benign
IGL01866:Mtrf1	APN	14	79401508	missense	probably benign
IGL02290:Mtrf1	APN	14	79401811	nonsense	probably null
IGL02929:Mtrf1	APN	14	79402833	missense	probably benign	0.00
IGL03342:Mtrf1	APN	14	79415980	missense	possibly damaging	0.80
IGL03342:Mtrf1	APN	14	79415871	splice site	probably benign
IGL03342:Mtrf1	APN	14	79415872	splice site	probably null
R0212:Mtrf1	UTSW	14	79419279	missense	probably benign	0.02
R0560:Mtrf1	UTSW	14	79406850	missense	probably damaging	1.00
R0604:Mtrf1	UTSW	14	79415887	missense	possibly damaging	0.92
R0669:Mtrf1	UTSW	14	79419268	nonsense	probably null
R0981:Mtrf1	UTSW	14	79401590	missense	probably benign	0.04
R1837:Mtrf1	UTSW	14	79401833	missense	possibly damaging	0.89
R1969:Mtrf1	UTSW	14	79401671	missense	probably damaging	1.00
R3883:Mtrf1	UTSW	14	79419267	missense	probably damaging	1.00
R4739:Mtrf1	UTSW	14	79413080	missense	probably damaging	1.00
R4748:Mtrf1	UTSW	14	79411650	missense	probably damaging	1.00
R4780:Mtrf1	UTSW	14	79401688	missense	probably benign	0.02
R4965:Mtrf1	UTSW	14	79406587	missense	probably benign
R5616:Mtrf1	UTSW	14	79401445	missense	possibly damaging	0.68
R6530:Mtrf1	UTSW	14	79402891	missense	possibly damaging	0.89
R6776:Mtrf1	UTSW	14	79413081	missense	probably damaging	1.00
R7095:Mtrf1	UTSW	14	79423491	frame shift	probably null
R7254:Mtrf1	UTSW	14	79423491	frame shift	probably null
R7871:Mtrf1	UTSW	14	79406938	missense	probably benign	0.19
R8249:Mtrf1	UTSW	14	79401479	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- CTTCAGTTCCATTGGGAGACAC -3'
(R):5'- GGAGAGCTGGATTATTTACTGAAACC -3'

Sequencing Primer
(F):5'- AGTTCCATTGGGAGACACACCTTC -3'
(R):5'- ACTCTATGCAAGAAATGTGAGTTTC -3'

Posted On

2019-06-26