Incidental Mutation 'R7182:Fmnl3'
ID 559075
Institutional Source Beutler Lab
Gene Symbol Fmnl3
Ensembl Gene ENSMUSG00000023008
Gene Name formin-like 3
Synonyms 2700073B04Rik, Wbp3
MMRRC Submission 045234-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.706) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 99215106-99268363 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 99219663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 695 (R695Q)
Ref Sequence ENSEMBL: ENSMUSP00000085566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000118287] [ENSMUST00000120633] [ENSMUST00000126955] [ENSMUST00000136980] [ENSMUST00000145482] [ENSMUST00000150636]
AlphaFold Q6ZPF4
Predicted Effect possibly damaging
Transcript: ENSMUST00000081224
AA Change: R644Q

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008
AA Change: R644Q

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088233
AA Change: R695Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008
AA Change: R695Q

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118287
SMART Domains Protein: ENSMUSP00000113282
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 694 777 N/A INTRINSIC
low complexity region 778 797 N/A INTRINSIC
low complexity region 810 826 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120633
AA Change: R695Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008
AA Change: R695Q

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126955
Predicted Effect probably benign
Transcript: ENSMUST00000136980
SMART Domains Protein: ENSMUSP00000122649
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
low complexity region 22 46 N/A INTRINSIC
low complexity region 50 81 N/A INTRINSIC
WW 87 119 7.6e-9 SMART
WW 128 160 1.75e-8 SMART
low complexity region 176 206 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
FF 270 324 2.36e-14 SMART
FF 404 464 6.94e-3 SMART
FF 484 544 1.41e0 SMART
FF 613 669 3.41e-11 SMART
low complexity region 681 764 N/A INTRINSIC
low complexity region 765 784 N/A INTRINSIC
low complexity region 797 813 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145482
SMART Domains Protein: ENSMUSP00000115869
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 708 N/A INTRINSIC
low complexity region 719 780 N/A INTRINSIC
low complexity region 781 800 N/A INTRINSIC
low complexity region 813 829 N/A INTRINSIC
low complexity region 848 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150636
SMART Domains Protein: ENSMUSP00000119295
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
Pfam:FF 1 52 1.2e-7 PFAM
low complexity region 67 82 N/A INTRINSIC
Meta Mutation Damage Score 0.3261 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a formin homology 2 domain and has high sequence identity to the mouse Wbp3 protein. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,578 (GRCm39) V323A unknown Het
AC117241.1 A G 17: 7,620,087 (GRCm39) V158A unknown Het
Acadm A G 3: 153,647,518 (GRCm39) probably null Het
Adcy10 T G 1: 165,371,039 (GRCm39) probably null Het
Aldh6a1 C T 12: 84,488,605 (GRCm39) A94T probably benign Het
Ano2 T A 6: 125,767,256 (GRCm39) L229Q probably damaging Het
Cacna1h C T 17: 25,596,629 (GRCm39) R1828H probably damaging Het
Ccdc33 A T 9: 57,941,456 (GRCm39) probably null Het
Cep112 A C 11: 108,573,670 (GRCm39) D6A probably benign Het
Chd9 T C 8: 91,733,250 (GRCm39) F1373S unknown Het
Cog5 T C 12: 31,735,707 (GRCm39) L158P probably damaging Het
Col6a3 G A 1: 90,731,400 (GRCm39) Q1618* probably null Het
Dlg5 A G 14: 24,294,924 (GRCm39) V3A Het
Dnah7a T A 1: 53,659,620 (GRCm39) probably null Het
Dpp10 A T 1: 123,268,880 (GRCm39) H716Q probably benign Het
Epor A G 9: 21,874,625 (GRCm39) F35L probably benign Het
Ergic1 A T 17: 26,873,856 (GRCm39) Y92F Het
Fam98a G A 17: 75,846,013 (GRCm39) Q273* probably null Het
Fhdc1 G A 3: 84,356,157 (GRCm39) T429I probably damaging Het
Fmnl2 T A 2: 52,997,453 (GRCm39) L468Q unknown Het
Gabrg2 T C 11: 41,811,333 (GRCm39) M271V probably damaging Het
Garin4 C T 1: 190,895,548 (GRCm39) R365H probably damaging Het
Gk5 G T 9: 96,001,579 (GRCm39) V26L possibly damaging Het
Gm14412 A C 2: 177,007,408 (GRCm39) N162K probably benign Het
Gm3604 T C 13: 62,519,689 (GRCm39) D22G probably damaging Het
Gm5565 G T 5: 146,094,865 (GRCm39) H294N probably benign Het
Hsf2 T A 10: 57,381,272 (GRCm39) D287E possibly damaging Het
Ift70b A T 2: 75,768,293 (GRCm39) Y153* probably null Het
Impdh2 G A 9: 108,440,407 (GRCm39) R231H possibly damaging Het
Irak3 T C 10: 120,002,416 (GRCm39) H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,648,765 (GRCm39) probably null Het
Lrch3 T A 16: 32,814,149 (GRCm39) D551E probably benign Het
Manba A T 3: 135,273,274 (GRCm39) N736I probably benign Het
Map2 A G 1: 66,451,812 (GRCm39) D234G possibly damaging Het
Mdk C A 2: 91,761,197 (GRCm39) K121N unknown Het
Mfn1 T A 3: 32,618,369 (GRCm39) L526Q probably damaging Het
Mfsd2b A G 12: 4,916,157 (GRCm39) probably null Het
Mnat1 G T 12: 73,277,452 (GRCm39) E233* probably null Het
Mtmr4 T C 11: 87,495,431 (GRCm39) probably null Het
Mtrf1 A G 14: 79,660,904 (GRCm39) E432G possibly damaging Het
Muc5b C T 7: 141,396,382 (GRCm39) R165C unknown Het
Naip6 T A 13: 100,452,657 (GRCm39) I135F probably benign Het
Nod2 A G 8: 89,390,460 (GRCm39) T256A probably benign Het
Notch4 T A 17: 34,802,473 (GRCm39) V1298E probably damaging Het
Nudc G T 4: 133,261,776 (GRCm39) D169E possibly damaging Het
Obscn A T 11: 58,925,927 (GRCm39) I5602N probably damaging Het
Or5b114-ps1 G A 19: 13,353,208 (GRCm39) G294E unknown Het
Osbpl10 G A 9: 114,896,319 (GRCm39) D18N probably damaging Het
Pigk G A 3: 152,428,188 (GRCm39) V72I possibly damaging Het
Prl8a6 C T 13: 27,621,153 (GRCm39) E26K probably damaging Het
Prpf8 A G 11: 75,381,553 (GRCm39) Y318C possibly damaging Het
Rab13 A G 3: 90,132,070 (GRCm39) D159G possibly damaging Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ryr2 T C 13: 11,774,643 (GRCm39) H1171R probably benign Het
Scn4a T A 11: 106,221,134 (GRCm39) I842F probably benign Het
Scnm1 A T 3: 95,041,165 (GRCm39) N14K possibly damaging Het
Serinc1 A T 10: 57,400,457 (GRCm39) I137N probably benign Het
Slc30a3 T C 5: 31,244,169 (GRCm39) Q371R probably benign Het
Slc30a3 A C 5: 31,247,014 (GRCm39) M103R probably damaging Het
Slco1a1 A T 6: 141,857,565 (GRCm39) C589S probably damaging Het
Slco1b2 A G 6: 141,602,656 (GRCm39) Y203C probably damaging Het
Spty2d1 A T 7: 46,648,271 (GRCm39) D219E probably benign Het
Svep1 A T 4: 58,043,991 (GRCm39) S3552T probably benign Het
Tmem62 A G 2: 120,835,224 (GRCm39) I516M probably benign Het
Trim61 A T 8: 65,466,266 (GRCm39) S332T probably damaging Het
Trmt10b A C 4: 45,308,520 (GRCm39) T227P probably benign Het
Trpc3 T C 3: 36,709,258 (GRCm39) Q406R probably benign Het
Ush2a A T 1: 188,485,740 (GRCm39) Y2950F probably benign Het
Usp32 C T 11: 84,930,996 (GRCm39) G478D probably benign Het
Wdfy3 A G 5: 102,091,758 (GRCm39) L527P possibly damaging Het
Wdr73 A G 7: 80,543,426 (GRCm39) V163A possibly damaging Het
Other mutations in Fmnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Fmnl3 APN 15 99,220,551 (GRCm39) missense probably damaging 1.00
IGL00672:Fmnl3 APN 15 99,223,562 (GRCm39) missense probably damaging 1.00
IGL00727:Fmnl3 APN 15 99,220,551 (GRCm39) missense probably damaging 1.00
IGL00754:Fmnl3 APN 15 99,220,551 (GRCm39) missense probably damaging 1.00
IGL00927:Fmnl3 APN 15 99,235,509 (GRCm39) critical splice donor site probably null
IGL02376:Fmnl3 APN 15 99,216,844 (GRCm39) missense possibly damaging 0.51
IGL02607:Fmnl3 APN 15 99,222,653 (GRCm39) missense probably damaging 1.00
IGL03323:Fmnl3 APN 15 99,219,162 (GRCm39) missense probably damaging 1.00
C9142:Fmnl3 UTSW 15 99,235,508 (GRCm39) splice site probably null
PIT4280001:Fmnl3 UTSW 15 99,219,134 (GRCm39) critical splice donor site probably null
R0003:Fmnl3 UTSW 15 99,219,013 (GRCm39) missense probably damaging 0.99
R0003:Fmnl3 UTSW 15 99,219,013 (GRCm39) missense probably damaging 0.99
R0116:Fmnl3 UTSW 15 99,220,619 (GRCm39) splice site probably benign
R0117:Fmnl3 UTSW 15 99,220,619 (GRCm39) splice site probably benign
R0137:Fmnl3 UTSW 15 99,220,619 (GRCm39) splice site probably benign
R0138:Fmnl3 UTSW 15 99,220,619 (GRCm39) splice site probably benign
R0701:Fmnl3 UTSW 15 99,219,188 (GRCm39) missense probably damaging 0.99
R2338:Fmnl3 UTSW 15 99,268,108 (GRCm39) missense probably benign 0.01
R3729:Fmnl3 UTSW 15 99,219,745 (GRCm39) missense probably damaging 0.99
R4707:Fmnl3 UTSW 15 99,221,362 (GRCm39) missense probably benign 0.00
R5346:Fmnl3 UTSW 15 99,229,871 (GRCm39) missense probably damaging 1.00
R5655:Fmnl3 UTSW 15 99,219,743 (GRCm39) missense probably damaging 0.99
R5916:Fmnl3 UTSW 15 99,219,709 (GRCm39) missense probably damaging 0.99
R5951:Fmnl3 UTSW 15 99,223,791 (GRCm39) missense probably damaging 1.00
R5954:Fmnl3 UTSW 15 99,223,791 (GRCm39) missense probably damaging 1.00
R5957:Fmnl3 UTSW 15 99,223,791 (GRCm39) missense probably damaging 1.00
R6334:Fmnl3 UTSW 15 99,235,534 (GRCm39) missense probably damaging 1.00
R6891:Fmnl3 UTSW 15 99,223,754 (GRCm39) missense probably damaging 1.00
R7423:Fmnl3 UTSW 15 99,227,281 (GRCm39) missense probably damaging 0.99
R7952:Fmnl3 UTSW 15 99,220,518 (GRCm39) missense probably damaging 0.97
R7977:Fmnl3 UTSW 15 99,225,979 (GRCm39) missense possibly damaging 0.89
R7987:Fmnl3 UTSW 15 99,225,979 (GRCm39) missense possibly damaging 0.89
R8749:Fmnl3 UTSW 15 99,219,322 (GRCm39) missense possibly damaging 0.88
R9397:Fmnl3 UTSW 15 99,225,938 (GRCm39) critical splice donor site probably null
R9598:Fmnl3 UTSW 15 99,223,210 (GRCm39) missense probably damaging 1.00
X0009:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0010:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0011:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0012:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0014:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0017:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0021:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99,223,165 (GRCm39) missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0028:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0033:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0060:Fmnl3 UTSW 15 99,217,919 (GRCm39) missense possibly damaging 0.69
X0064:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
X0067:Fmnl3 UTSW 15 99,220,208 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTCACAGCAGTGCATAG -3'
(R):5'- AGTTTATCGGGCGGGAACAG -3'

Sequencing Primer
(F):5'- TGGTCACAGCAGTGCATAGTAATTAG -3'
(R):5'- GAACAGCATCAGCAGCTGTGTC -3'
Posted On 2019-06-26