Incidental Mutation 'R7182:4930562C15Rik'
ID559076
Institutional Source Beutler Lab
Gene Symbol 4930562C15Rik
Ensembl Gene ENSMUSG00000022518
Gene NameRIKEN cDNA 4930562C15 gene
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_030192.1; MGI:1926059

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7182 (G1)
Quality Score196.009
Status Not validated
Chromosome16
Chromosomal Location4835416-4867686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4849714 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 323 (V323A)
Ref Sequence ENSEMBL: ENSMUSP00000097784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100211]
Predicted Effect unknown
Transcript: ENSMUST00000100211
AA Change: V323A
SMART Domains Protein: ENSMUSP00000097784
Gene: ENSMUSG00000022518
AA Change: V323A

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
coiled coil region 181 211 N/A INTRINSIC
internal_repeat_1 289 315 2.54e-5 PROSPERO
internal_repeat_1 314 341 2.54e-5 PROSPERO
low complexity region 360 377 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
low complexity region 573 604 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
Pfam:DUF4795 745 960 1.7e-46 PFAM
low complexity region 1095 1109 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in 4930562C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:4930562C15Rik APN 16 4864646 missense probably benign 0.31
IGL01610:4930562C15Rik APN 16 4851565 splice site probably benign
IGL02869:4930562C15Rik APN 16 4867459 missense possibly damaging 0.68
IGL03242:4930562C15Rik APN 16 4849325 missense unknown
R0063:4930562C15Rik UTSW 16 4861048 nonsense probably null
R0063:4930562C15Rik UTSW 16 4861048 nonsense probably null
R0083:4930562C15Rik UTSW 16 4849542 missense unknown
R0565:4930562C15Rik UTSW 16 4864336 missense probably benign 0.22
R0630:4930562C15Rik UTSW 16 4850939 missense possibly damaging 0.90
R0734:4930562C15Rik UTSW 16 4850334 missense probably benign 0.01
R1200:4930562C15Rik UTSW 16 4849672 missense unknown
R1738:4930562C15Rik UTSW 16 4864611 missense probably damaging 1.00
R1775:4930562C15Rik UTSW 16 4851558 unclassified probably null
R1945:4930562C15Rik UTSW 16 4835685 missense unknown
R2132:4930562C15Rik UTSW 16 4835971 missense unknown
R2445:4930562C15Rik UTSW 16 4864397 splice site probably null
R2696:4930562C15Rik UTSW 16 4850364 missense probably benign 0.04
R4729:4930562C15Rik UTSW 16 4849323 missense unknown
R4779:4930562C15Rik UTSW 16 4849749 missense unknown
R4806:4930562C15Rik UTSW 16 4849672 missense unknown
R4808:4930562C15Rik UTSW 16 4849672 missense unknown
R4876:4930562C15Rik UTSW 16 4849672 missense unknown
R4931:4930562C15Rik UTSW 16 4861046 missense possibly damaging 0.47
R4956:4930562C15Rik UTSW 16 4854952 missense probably damaging 0.99
R5085:4930562C15Rik UTSW 16 4835973 nonsense probably null
R5203:4930562C15Rik UTSW 16 4835598 missense unknown
R5229:4930562C15Rik UTSW 16 4850051 missense possibly damaging 0.73
R5461:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5462:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5464:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5595:4930562C15Rik UTSW 16 4864279 missense probably benign 0.01
R6054:4930562C15Rik UTSW 16 4835865 missense unknown
R6405:4930562C15Rik UTSW 16 4851878 missense probably damaging 0.97
R6859:4930562C15Rik UTSW 16 4851935 missense possibly damaging 0.86
R7124:4930562C15Rik UTSW 16 4864332 missense probably benign 0.02
R7139:4930562C15Rik UTSW 16 4850184 missense probably benign 0.00
R7219:4930562C15Rik UTSW 16 4849644 missense unknown
R7366:4930562C15Rik UTSW 16 4835769 missense unknown
R7592:4930562C15Rik UTSW 16 4849274 missense unknown
R7759:4930562C15Rik UTSW 16 4864650 missense probably benign 0.01
R7789:4930562C15Rik UTSW 16 4864311 missense probably benign 0.01
R7873:4930562C15Rik UTSW 16 4866227 missense probably benign
R7956:4930562C15Rik UTSW 16 4866227 missense probably benign
X0028:4930562C15Rik UTSW 16 4867367 missense possibly damaging 0.83
Z1176:4930562C15Rik UTSW 16 4866248 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GATGCTGGCTACATCCATATCC -3'
(R):5'- TAGTTACCCCTAGCCAAGCC -3'

Sequencing Primer
(F):5'- TCCATATCCCCATCCACAGTG -3'
(R):5'- ATTCCAGGTCTAGGCCCATAG -3'
Posted On2019-06-26