Mutagenetix > Incidental Mutation

Incidental Mutation 'R0590:Gls'

55908

Institutional Source

Beutler Lab

Gene Symbol

Gls

Ensembl Gene

ENSMUSG00000026103

Gene Name

glutaminase

Synonyms

MMRRC Submission

038780-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0590 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52163448-52233232 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 52212375 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115358 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114510] [ENSMUST00000114512] [ENSMUST00000114513] [ENSMUST00000155587]

AlphaFold

D3Z7P3

Predicted Effect

probably benign
Transcript: ENSMUST00000114510

SMART Domains

Protein: ENSMUSP00000110155
Gene: ENSMUSG00000026103

Domain	Start	End	E-Value	Type
low complexity region	56	77	N/A	INTRINSIC
low complexity region	89	110	N/A	INTRINSIC
Pfam:Glutaminase	249	535	3e-127	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114512

SMART Domains

Protein: ENSMUSP00000110157
Gene: ENSMUSG00000026103

Domain	Start	End	E-Value	Type
Pfam:Glutaminase	66	352	1.7e-125	PFAM
ANK	407	437	3.9e-6	SMART
ANK	441	470	3.6e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114513

SMART Domains

Protein: ENSMUSP00000110158
Gene: ENSMUSG00000026103

Domain	Start	End	E-Value	Type
low complexity region	56	77	N/A	INTRINSIC
low complexity region	89	110	N/A	INTRINSIC
Pfam:Glutaminase	249	535	4.2e-123	PFAM
ANK	590	620	6.02e-4	SMART
ANK	624	653	5.69e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142976

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145514

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147825

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151694

Predicted Effect

probably benign
Transcript: ENSMUST00000155587

SMART Domains

Protein: ENSMUSP00000115358
Gene: ENSMUSG00000026103

Domain	Start	End	E-Value	Type
Pfam:Glutaminase	1	206	2.4e-92	PFAM

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations die within 1 day postnatally with abnormal respiratory function and goal-oriented behavior toward dam. Mice homozygous for another allele exhibit abnormal TNFA-stimulated astrocyte extracellular vesicle release. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat2	C	T	4: 49,383,273	M93I	probably benign	Het
Adamts16	T	C	13: 70,800,954	D196G	probably benign	Het
Adhfe1	T	A	1: 9,548,153		probably null	Het
AI661453	A	G	17: 47,467,074		probably benign	Het
Apc	G	T	18: 34,316,230	E2026*	probably null	Het
Atg2a	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	19: 6,245,007		probably benign	Het
BC017158	A	G	7: 128,297,470	L134P	probably damaging	Het
Cad	T	C	5: 31,062,231	S688P	probably damaging	Het
Ccdc191	C	T	16: 43,931,341	R345*	probably null	Het
Dcaf13	T	A	15: 39,145,085		probably benign	Het
Drc1	A	G	5: 30,363,136	D607G	probably benign	Het
Fam160a1	T	C	3: 85,672,376	R841G	probably benign	Het
Gli1	G	T	10: 127,331,563	A607E	possibly damaging	Het
Gria1	A	T	11: 57,289,409	Q728H	probably damaging	Het
Hcrtr1	A	G	4: 130,135,694	L198P	probably damaging	Het
Ifngr1	T	A	10: 19,603,942		probably benign	Het
Ipo5	T	C	14: 120,944,357	V954A	possibly damaging	Het
Kcnh5	G	T	12: 74,965,261	A628D	probably damaging	Het
Kif14	T	C	1: 136,482,472	S646P	probably damaging	Het
Ksr1	A	G	11: 79,045,140	S133P	probably damaging	Het
Neb	T	C	2: 52,137,290	M7143V	probably damaging	Het
Nelfa	G	A	5: 33,901,825	P229S	probably damaging	Het
Nfatc2	T	C	2: 168,571,199	T169A	probably damaging	Het
Nr1h4	A	G	10: 89,456,567	Y398H	probably damaging	Het
Nrcam	A	G	12: 44,564,032	E511G	probably damaging	Het
Ocstamp	T	A	2: 165,397,751	R172W	probably damaging	Het
Olfr1130	A	G	2: 87,607,994	E202G	probably damaging	Het
Olfr26	T	A	9: 38,855,470	M136K	probably damaging	Het
Olfr27	T	C	9: 39,144,721	V207A	probably benign	Het
Phf14	G	A	6: 11,961,578	V405I	possibly damaging	Het
Plk5	G	A	10: 80,360,223	R238H	probably damaging	Het
Pole	A	G	5: 110,317,926	E1240G	probably benign	Het
Prdm15	A	G	16: 97,797,761	I899T	possibly damaging	Het
Psip1	T	C	4: 83,458,144	N486S	probably benign	Het
Rlf	A	G	4: 121,170,833		probably benign	Het
Rttn	T	C	18: 88,979,635	S255P	probably damaging	Het
Sema6c	A	G	3: 95,172,623	K711E	probably damaging	Het
Slc4a10	A	T	2: 62,190,893		probably benign	Het
Trim36	T	G	18: 46,172,576	S435R	probably benign	Het
Ucp1	A	G	8: 83,291,603		probably benign	Het
Vmn1r17	T	C	6: 57,361,014	Y122C	probably benign	Het
Vmn1r23	A	G	6: 57,926,364	V143A	probably benign	Het
Wdfy4	T	A	14: 33,041,174	Q2166L	probably benign	Het
Zc3h7b	C	T	15: 81,776,998	T346M	possibly damaging	Het
Zfhx4	T	A	3: 5,402,633	V2617D	probably damaging	Het

Other mutations in Gls

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01339:Gls	APN	1	52188708	missense	probably damaging	1.00
IGL01366:Gls	APN	1	52168399	missense	probably damaging	1.00
IGL01367:Gls	APN	1	52168399	missense	probably damaging	1.00
IGL01832:Gls	APN	1	52168409	splice site	probably null
IGL02045:Gls	APN	1	52219515	missense	probably benign	0.01
LCD18:Gls	UTSW	1	52183367	intron	probably benign
R0268:Gls	UTSW	1	52232694	small deletion	probably benign
R0373:Gls	UTSW	1	52188699	missense	probably damaging	1.00
R1440:Gls	UTSW	1	52191134	missense	possibly damaging	0.59
R1628:Gls	UTSW	1	52232676	missense	probably benign	0.06
R3684:Gls	UTSW	1	52166293	missense	probably damaging	1.00
R3697:Gls	UTSW	1	52199764	missense	possibly damaging	0.65
R3778:Gls	UTSW	1	52168912	missense	probably benign	0.05
R3824:Gls	UTSW	1	52232988	missense	possibly damaging	0.83
R4062:Gls	UTSW	1	52196748	missense	probably damaging	1.00
R4441:Gls	UTSW	1	52196163	critical splice donor site	probably null
R4740:Gls	UTSW	1	52232788	missense	probably damaging	0.99
R4816:Gls	UTSW	1	52199945	intron	probably benign
R5281:Gls	UTSW	1	52191157	missense	probably damaging	1.00
R5712:Gls	UTSW	1	52196752	missense	probably damaging	1.00
R6163:Gls	UTSW	1	52215576	missense	probably benign	0.00
R6357:Gls	UTSW	1	52219506	missense	probably damaging	0.99
R6498:Gls	UTSW	1	52220039	missense	probably benign
R7187:Gls	UTSW	1	52219980	missense	probably damaging	1.00
R7413:Gls	UTSW	1	52215576	missense	probably benign	0.00
R7545:Gls	UTSW	1	52191152	missense	probably damaging	1.00
R7627:Gls	UTSW	1	52166266	missense	probably benign	0.00
R7648:Gls	UTSW	1	52196780	missense	probably damaging	0.99
R7781:Gls	UTSW	1	52212333	nonsense	probably null
R7979:Gls	UTSW	1	52191112	missense	probably damaging	0.99
R8488:Gls	UTSW	1	52199853	critical splice donor site	probably null
R9179:Gls	UTSW	1	52199856	missense	probably damaging	1.00
R9240:Gls	UTSW	1	52168394	missense	probably benign	0.00
R9550:Gls	UTSW	1	52212214	nonsense	probably null
R9667:Gls	UTSW	1	52190877	critical splice donor site	probably null
R9721:Gls	UTSW	1	52212268	missense	probably damaging	1.00
Z1176:Gls	UTSW	1	52214488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCCATTTGTAGGTACTCCTTACCAT -3'
(R):5'- GCCACCTTTACTACAGCATCATCTAGC -3'

Sequencing Primer
(F):5'- ACTCCTTACCATCTTCATTCAAAAAG -3'
(R):5'- tagtgaggggggggagg -3'

Posted On

2013-07-11