Incidental Mutation 'R7182:Rgl2'
ID559081
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Nameral guanine nucleotide dissociation stimulator-like 2
SynonymsKE1.5, Rab2l, Rgt2, Rlf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7182 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33929543-33937687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33934990 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 457 (F457L)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000174426] [ENSMUST00000179418]
PDB Structure
STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000047503
AA Change: F457L

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: F457L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: F21L

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Meta Mutation Damage Score 0.8096 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,714 V323A unknown Het
AC117241.1 A G 17: 7,352,688 V158A unknown Het
Acadm A G 3: 153,941,881 probably null Het
Adcy10 T G 1: 165,543,470 probably null Het
Aldh6a1 C T 12: 84,441,831 A94T probably benign Het
Ano2 T A 6: 125,790,293 L229Q probably damaging Het
Cacna1h C T 17: 25,377,655 R1828H probably damaging Het
Ccdc33 A T 9: 58,034,173 probably null Het
Cep112 A C 11: 108,682,844 D6A probably benign Het
Chd9 T C 8: 91,006,622 F1373S unknown Het
Cog5 T C 12: 31,685,708 L158P probably damaging Het
Col6a3 G A 1: 90,803,678 Q1618* probably null Het
Dlg5 A G 14: 24,244,856 V3A Het
Dnah7a T A 1: 53,620,461 probably null Het
Dpp10 A T 1: 123,341,151 H716Q probably benign Het
Epor A G 9: 21,963,329 F35L probably benign Het
Ergic1 A T 17: 26,654,882 Y92F Het
Fam71a C T 1: 191,163,351 R365H probably damaging Het
Fam98a G A 17: 75,539,018 Q273* probably null Het
Fhdc1 G A 3: 84,448,850 T429I probably damaging Het
Fmnl2 T A 2: 53,107,441 L468Q unknown Het
Fmnl3 C T 15: 99,321,782 R695Q probably damaging Het
Gabrg2 T C 11: 41,920,506 M271V probably damaging Het
Gk5 G T 9: 96,119,526 V26L possibly damaging Het
Gm14412 A C 2: 177,315,615 N162K probably benign Het
Gm3604 T C 13: 62,371,875 D22G probably damaging Het
Gm5565 G T 5: 146,158,055 H294N probably benign Het
Hsf2 T A 10: 57,505,176 D287E possibly damaging Het
Impdh2 G A 9: 108,563,208 R231H possibly damaging Het
Irak3 T C 10: 120,166,511 H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,741,458 probably null Het
Lrch3 T A 16: 32,993,779 D551E probably benign Het
Manba A T 3: 135,567,513 N736I probably benign Het
Map2 A G 1: 66,412,653 D234G possibly damaging Het
Mdk C A 2: 91,930,852 K121N unknown Het
Mfn1 T A 3: 32,564,220 L526Q probably damaging Het
Mfsd2b A G 12: 4,866,157 probably null Het
Mnat1 G T 12: 73,230,678 E233* probably null Het
Mtmr4 T C 11: 87,604,605 probably null Het
Mtrf1 A G 14: 79,423,464 E432G possibly damaging Het
Muc5b C T 7: 141,842,645 R165C unknown Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Nod2 A G 8: 88,663,832 T256A probably benign Het
Notch4 T A 17: 34,583,499 V1298E probably damaging Het
Nudc G T 4: 133,534,465 D169E possibly damaging Het
Obscn A T 11: 59,035,101 I5602N probably damaging Het
Olfr1468-ps1 G A 19: 13,375,844 G294E unknown Het
Osbpl10 G A 9: 115,067,251 D18N probably damaging Het
Pigk G A 3: 152,722,551 V72I possibly damaging Het
Prl8a6 C T 13: 27,437,170 E26K probably damaging Het
Prpf8 A G 11: 75,490,727 Y318C possibly damaging Het
Rab13 A G 3: 90,224,763 D159G possibly damaging Het
Ryr2 T C 13: 11,759,757 H1171R probably benign Het
Scn4a T A 11: 106,330,308 I842F probably benign Het
Scnm1 A T 3: 95,133,854 N14K possibly damaging Het
Serinc1 A T 10: 57,524,361 I137N probably benign Het
Slc30a3 T C 5: 31,086,825 Q371R probably benign Het
Slc30a3 A C 5: 31,089,670 M103R probably damaging Het
Slco1a1 A T 6: 141,911,839 C589S probably damaging Het
Slco1b2 A G 6: 141,656,930 Y203C probably damaging Het
Spty2d1 A T 7: 46,998,523 D219E probably benign Het
Svep1 A T 4: 58,043,991 S3552T probably benign Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Trim61 A T 8: 65,013,614 S332T probably damaging Het
Trmt10b A C 4: 45,308,520 T227P probably benign Het
Trpc3 T C 3: 36,655,109 Q406R probably benign Het
Ttc30b A T 2: 75,937,949 Y153* probably null Het
Ush2a A T 1: 188,753,543 Y2950F probably benign Het
Usp32 C T 11: 85,040,170 G478D probably benign Het
Wdfy3 A G 5: 101,943,892 L527P possibly damaging Het
Wdr73 A G 7: 80,893,678 V163A possibly damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 33933136 missense probably benign 0.31
IGL00898:Rgl2 APN 17 33933418 missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 33935936 missense probably benign 0.00
IGL00985:Rgl2 APN 17 33932101 missense probably damaging 1.00
IGL02140:Rgl2 APN 17 33933124 missense probably damaging 1.00
IGL02214:Rgl2 APN 17 33935189 missense probably benign 0.06
IGL02486:Rgl2 APN 17 33935980 missense probably damaging 0.97
IGL02579:Rgl2 APN 17 33937160 missense probably benign 0.08
IGL02976:Rgl2 APN 17 33933962 missense possibly damaging 0.95
Pedernales UTSW 17 33932038 critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 33933940 missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 33932738 missense probably damaging 1.00
R0456:Rgl2 UTSW 17 33936849 splice site probably null
R0825:Rgl2 UTSW 17 33935159 splice site probably null
R1742:Rgl2 UTSW 17 33937223 unclassified probably null
R1777:Rgl2 UTSW 17 33931744 missense probably benign 0.00
R1829:Rgl2 UTSW 17 33933621 missense probably benign 0.00
R1908:Rgl2 UTSW 17 33932148 missense probably benign 0.00
R1961:Rgl2 UTSW 17 33933615 missense probably damaging 1.00
R2102:Rgl2 UTSW 17 33933340 splice site probably null
R3001:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3002:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3755:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3756:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3978:Rgl2 UTSW 17 33935162 missense probably benign 0.02
R4042:Rgl2 UTSW 17 33937262 missense probably damaging 1.00
R4064:Rgl2 UTSW 17 33937108 missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 33936932 missense probably benign 0.04
R4661:Rgl2 UTSW 17 33933226 missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 33937173 missense probably benign 0.00
R4922:Rgl2 UTSW 17 33932775 unclassified probably benign
R5119:Rgl2 UTSW 17 33937120 missense probably benign 0.00
R5167:Rgl2 UTSW 17 33935974 nonsense probably null
R5279:Rgl2 UTSW 17 33935948 missense probably benign
R5319:Rgl2 UTSW 17 33933555 missense probably benign 0.02
R5337:Rgl2 UTSW 17 33934984 missense probably damaging 0.99
R5881:Rgl2 UTSW 17 33932717 missense probably benign 0.01
R5945:Rgl2 UTSW 17 33932038 critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 33931765 missense probably benign 0.01
R6358:Rgl2 UTSW 17 33937131 unclassified probably null
R6867:Rgl2 UTSW 17 33932687 missense probably benign 0.09
R7174:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7203:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7250:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7253:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7455:Rgl2 UTSW 17 33932683 missense probably benign 0.32
R7513:Rgl2 UTSW 17 33932555 missense probably benign
R7752:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7984:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R8158:Rgl2 UTSW 17 33936944 missense probably benign 0.27
X0028:Rgl2 UTSW 17 33932458 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CTGAGTGTCAAGTGGAGCTG -3'
(R):5'- TTCTTTCTGGAGGCGCAACAG -3'

Sequencing Primer
(F):5'- GCTACACAGTGAGTCCCAGTCTC -3'
(R):5'- GGCGCAACAGCTCCGAAAG -3'
Posted On2019-06-26